Decreased expression of the p16/MTS1 gene without mutation is frequent in human urinary bladder carcinomas

doi:10.1093/jjco/27.1.22

This Article

	Abstract
	FREE Full Text (PDF)
	Alert me when this article is cited
	Alert me if a correction is posted

Services

	Email this article to a friend
	Similar articles in this journal
	Similar articles in ISI Web of Science
	Similar articles in PubMed
	Alert me to new issues of the journal
	Add to My Personal Archive
	Download to citation manager
	Search for citing articles in: ISI Web of Science (7)
	Request Permissions

Google Scholar

	Articles by Asamoto, M
	Articles by Tsuda, H
	Search for Related Content

PubMed

	PubMed Citation
	Articles by Asamoto, M
	Articles by Tsuda, H

Social Bookmarking

	What's this?

Japanese Journal of Clinical Oncology Pages 22-25

Decreased Expression of the p16/MTS1 Gene without Mutation is Frequent in Human Urinary Bladder Carcinomas
Introduction
Materials and Methods
Results
Discussion
References

Decreased Expression of the p16/MTS1 Gene without Mutation is Frequent in Human Urinary Bladder Carcinomas

Decreased Expression of the p16/MTS1 Gene without Mutation is Frequent in Human Urinary Bladder Carcinomas Makoto Asamoto¹, Yoshio Iwahori¹, Takehiko Okamura², Tomoyuki Shirai³ and Hiroyuki Tsuda¹

¹Chemotherapy Division, National Cancer Center Research Institute, Tokyo, ²Department of Urology, Nagoya City University Medical School, Nagoya and ³First Department of Pathology, Nagoya City University Medical School, Nagoya, Japan

The p16 (CDKN2,MTS1) gene is located at 9p21 and its product, p16, inhibits the cyclin D/CDK4 complex. Loss of heterozygosity on chromosome 9p is very common in human bladder carcinomas and has been found in all stages of lesions, suggesting that it occurs early in bladder tumor progression. Several studies have revealed frequent homozygous deletion of the p16 gene in cell lines, and that such deletions are also common in some types of cancers. In addition, point mutations in the p16 gene have been identified in several types of neoplasia. In the present examination of urinary bladder tumors, no p16 gene mutations were detected, but nine cases out of 23 (39%) showed decreased mRNA expression, revealed by the reverse transcriptase polymerase chain reaction. There were no histological differences apparent between those cases with normal and those with decreased p16 expression. These results indicate that while p16 gene mutations may be rare, changes in the level of the p16 transcripts could play a role in human bladder carcinoma development.

Key words: p16 - point mutation - gene expression - human urinary bladder carcinomas

Introduction

Loss of heterozygosity (LOH) of chromosome 9p21 has been found in several types of malignant tumors, including these arising in the urinary bladder (1 -5 ). This indicates that the chromosomal region contains at least one tumor suppressor gene which may play an important role in development or progression of many types of tumors. In bladder carcinomas, LOH of chromosome 9 is the most frequent genetic change, deletion occurring in all grades and stages (6 ,7 ). Inactivation of a tumor suppressor gene on chromosome 9 is, therefore, a possible initiating event in bladder carcinogenesis.

Recently, a gene encoding a 16 kDa protein was cloned from 9p21 to 2 (8 ,9 ). This p16 protein is an inhibitor of the cyclin dependent kinase which catalyzes the phosphorylation of retinoblastoma gene protein, releasing transcription factor E2F and resulting in progression from the G1 phase to the S phase of the cell cycle (10 ). Thus, the p16 protein can negatively regulate the cell cycle and is a candidate 9p21 tumor suppressor gene. Homozygous deletions of the p16 gene have been observed frequently in cancer-cell lines established from many types of tissues, including the bladder (5 ,8 ), and germline mutations have been identified in patients in families with a genetic predisposition for melanoma development (11 ,12 ). Furthermore, somatic mutations have been found in primary esophageal (13 ), pancreatic (14 ) and lung carcinomas (15 ).

To investigate the involvement of p16 gene alterations in primary bladder carcinomas, we identified somatic mutations in 23 cases using the polymerase chain reaction (PCR) and single strand conformation polymorphism (SSCP) method for all three exons of the p16 gene in addition to determining mRNA expression by the reverse transcriptase (RT) PCR technique.

Materials and Methods

Twenty-three primary bladder carcinomas were obtained by trans-urethral resection in the Department of Urology, Nagoya City University Medical School. After removal of a biopsy, each specimen was immediately frozen in liquid nitrogen and stored at -80°C. Total RNA and DNA samples were extracted simultaneously from frozen tissue using ISOGEN (Nippon Gene Co. Ltd. Toyama, Japan) according to the manufacturers instructions. Biopsies from each tumor were also processed for routine histological examination. All tumors were diagnosed as transitional cell carcinomas. ASPC-1 and T24 cell lines obtained from the ATCC and Japanese Cancer Research Resources Bank, respectively, were used as positive and negative controls for the p16 gene mutation analysis (14 ,16 ).

To screen for p16 gene somatic mutations, PCR-SSCP was performed. First, exons 1 and 2 with flanking intronic sequences were amplified by PCR using the following primers: for exon 1,

Ex1A (CGGAGAGGGGGAGAACAG) andEx1B (TCCCCTTTTTCCGGAGAATCG)

for exon 2,Ex2A (GCTCTACACAAGCTTCCTTTCC) and Ex2B (GGGCTGAACTTTCTGTGCTGG).

The PCR conditions were one cycle at 95°C (5 min); four cycles at 95°C (30 s) with the annealing temperature (T_ann) = 72°C (30 s); four cycles with T_ann = 68°C (30 s); four cycles with T_ann = 66°C (30 s); four cycles with T_ann = 64°C (30 s); four cycles with T_ann = 62°C (30 s) ; and 30 cycles with T_ann = 60°C . Dimethyl sulfoxide was added to the reaction mixture at 5%. Secondary PCR was carried out using 1 µl of the diluted (1:100) first fragments with primers Ex1A and Ex1B for exon 1, or Ex2A and Ex2B for exon 2 as templates, 2 pmol of each primer, 25 µM of deoxynucleotide triphosphates, 2 µCi of [alpha]-³²PdCTP (Amersham, 3000 µCi/mmol), 10 mM Tris (pH 8.3), 50 mM KCL, 1.5 mM MgCl_{2 ,}12% DMSO (dimethyl sulphoxide) and 0.125 of a unit of Taq polymerase (Perkin-Elmer Cetus) in a final volume of 5 µl. Primer sequences and annealing temperatures were taken from published data (11 ).

For exon 1, primersX1.31F (GGGAGCAGCATGGAGCCG) andX1.26R (AGTCGCCCGCCATCCCCT) were used.

Exon 2 was divided into three parts and amplified with overlapping sequences to increase the sensitivity of detection of mutations by SSCP.

For exon 2a,X2.62F (AGCTTCCTTCCGTCATGC) and286R (GCAGCACCACCAGCGTG);

for exon 2b,F200 (AGCCCAACTGCGCCGAC) and346R (CCAGGTCCACGGGCAGA);

and for exon 2c305F (TGGACGTGCGCGATGC) andX2.42R (GGAAGCTCTCAGGGTACAAATTC) were used as primers.

To analyze exon 3, the same conditions as for the secondary PCR for exons 1 and 2 were applied, except for application of genomic DNA as the PCR template instead of the PCR products, using primers X3.90F (CCGGTAGGGACGGCAAGAGA) and530R (CTGTAGGACCCTCGGTGACTGATGA). Thirty cycles were performed of: 1 min at 94°C, followed by 1 min at 63°C for exon 1, at 55°C for exon 2 and at 60°C for exon 3, and finally 1.5 min at 72°C. Forty-five µl of stop solution [95% formamide, 20 mM EDTA (ethylenediaminetetra-acetic acid), 0.05% bromophenol blue, 0.05% xylene cyanol] was then added to the reaction mixture and after heating at 80°C for 2 min, 1 µl aliquots of samples were loaded onto 5% polyacrylamide gels (acrylamide:bis ratio, 49:1) with or without 5% glycerol. Gels were run at 30 W with a water jacket at 25°C for 3 h before drying at 80°C and performance of autoradiography for 1-2 h.

To investigate the mRNA expression, the RT-PCR method was applied. Total RNA (1 µg) treated with RNase-free DNase was incubated with oligo d (T)20 primers and AMV reverse transcriptase at 60°C for 30 min. The 363 bp cDNA stretch corresponding to the first and second exons of p16 was amplified by primers p16U (GGGGTTCGGGTAGAGGAGGTG) and p16D (CATGGTTACTGCCTCTGGTG) with an RNA PCR kit (TaKaRa Co. Ltd., Otsu, Japan). The PCR conditions were the same as used for the exon 1 or 2 amplification. G3PDH expression was also examined as an internal control for RT-PCR with primers purchased from Clontech Laboratories, Inc. (Palo Alto, California, USA). Thirty cycles were performed at 94°C, 60°C, and 72°C for 1, 1, and 1.5 min, respectively. Reaction products for p16 and the corresponding G3PDH were placed into the same wells and separated on 1% agarose gels before staining with ethidium bromide for visualization.

Results

We investigated somatic mutations in all three exons of the p16 gene in 23 primary bladder carcinomas and the T24 bladder carcinoma cell line using the PCR-SSCP method. However, no mutations were detected in any of the tumors or the T24 cells (16 ). As a positive control, the pancreatic cell line ASPC-1 which has a mutation in exon 2 of the p16 gene was used. The presence of the mutation was confirmed (14 ). Representative photographs of the results of SSCP analysis for exons 1 and 2b (the middle part of exon 2) are shown in Fig. 1 .

				E. J. Chapman, P. Harnden, P. Chambers, C. Johnston, and M. A. Knowles Comprehensive Analysis of CDKN2A Status in Microdissected Urothelial Cell Carcinoma Reveals Potential Haploinsufficiency, a High Frequency of Homozygous Co-deletion and Associations with Clinical Phenotype Clin. Cancer Res., August 15, 2005; 11(16): 5740 - 5747. [Abstract] [Full Text] [PDF]