Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrow Request Permissions
Google Scholar
Right arrow Articles by Asamoto, M
Right arrow Articles by Tsuda, H
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Asamoto, M
Right arrow Articles by Tsuda, H
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Japanese Journal of Clinical Oncology Pages 22-25


Decreased Expression of the p16/MTS1 Gene without Mutation is Frequent in Human Urinary Bladder Carcinomas
Introduction
Materials and Methods
Results
Discussion
References

Decreased Expression of the p16/MTS1 Gene without Mutation is Frequent in Human Urinary Bladder Carcinomas

Decreased Expression of the p16/MTS1 Gene without Mutation is Frequent in Human Urinary Bladder Carcinomas Makoto Asamoto1, Yoshio Iwahori1, Takehiko Okamura2, Tomoyuki Shirai3 and Hiroyuki Tsuda1

1Chemotherapy Division, National Cancer Center Research Institute, Tokyo, 2Department of Urology, Nagoya City University Medical School, Nagoya and 3First Department of Pathology, Nagoya City University Medical School, Nagoya, Japan

The p16 (CDKN2,MTS1) gene is located at 9p21 and its product, p16, inhibits the cyclin D/CDK4 complex. Loss of heterozygosity on chromosome 9p is very common in human bladder carcinomas and has been found in all stages of lesions, suggesting that it occurs early in bladder tumor progression. Several studies have revealed frequent homozygous deletion of the p16 gene in cell lines, and that such deletions are also common in some types of cancers. In addition, point mutations in the p16 gene have been identified in several types of neoplasia. In the present examination of urinary bladder tumors, no p16 gene mutations were detected, but nine cases out of 23 (39%) showed decreased mRNA expression, revealed by the reverse transcriptase polymerase chain reaction. There were no histological differences apparent between those cases with normal and those with decreased p16 expression. These results indicate that while p16 gene mutations may be rare, changes in the level of the p16 transcripts could play a role in human bladder carcinoma development.

Key words: p16 - point mutation - gene expression - human urinary bladder carcinomas

Introduction

Loss of heterozygosity (LOH) of chromosome 9p21 has been found in several types of malignant tumors, including these arising in the urinary bladder (1 -5 ). This indicates that the chromosomal region contains at least one tumor suppressor gene which may play an important role in development or progression of many types of tumors. In bladder carcinomas, LOH of chromosome 9 is the most frequent genetic change, deletion occurring in all grades and stages (6 ,7 ). Inactivation of a tumor suppressor gene on chromosome 9 is, therefore, a possible initiating event in bladder carcinogenesis.

Recently, a gene encoding a 16 kDa protein was cloned from 9p21 to 2 (8 ,9 ). This p16 protein is an inhibitor of the cyclin dependent kinase which catalyzes the phosphorylation of retinoblastoma gene protein, releasing transcription factor E2F and resulting in progression from the G1 phase to the S phase of the cell cycle (10 ). Thus, the p16 protein can negatively regulate the cell cycle and is a candidate 9p21 tumor suppressor gene. Homozygous deletions of the p16 gene have been observed frequently in cancer-cell lines established from many types of tissues, including the bladder (5 ,8 ), and germline mutations have been identified in patients in families with a genetic predisposition for melanoma development (11 ,12 ). Furthermore, somatic mutations have been found in primary esophageal (13 ), pancreatic (14 ) and lung carcinomas (15 ).

To investigate the involvement of p16 gene alterations in primary bladder carcinomas, we identified somatic mutations in 23 cases using the polymerase chain reaction (PCR) and single strand conformation polymorphism (SSCP) method for all three exons of the p16 gene in addition to determining mRNA expression by the reverse transcriptase (RT) PCR technique.

Materials and Methods

Twenty-three primary bladder carcinomas were obtained by trans-urethral resection in the Department of Urology, Nagoya City University Medical School. After removal of a biopsy, each specimen was immediately frozen in liquid nitrogen and stored at -80°C. Total RNA and DNA samples were extracted simultaneously from frozen tissue using ISOGEN (Nippon Gene Co. Ltd. Toyama, Japan) according to the manufacturers instructions. Biopsies from each tumor were also processed for routine histological examination. All tumors were diagnosed as transitional cell carcinomas. ASPC-1 and T24 cell lines obtained from the ATCC and Japanese Cancer Research Resources Bank, respectively, were used as positive and negative controls for the p16 gene mutation analysis (14 ,16 ).

To screen for p16 gene somatic mutations, PCR-SSCP was performed. First, exons 1 and 2 with flanking intronic sequences were amplified by PCR using the following primers: for exon 1,

Ex1A (CGGAGAGGGGGAGAACAG) andEx1B (TCCCCTTTTTCCGGAGAATCG)

for exon 2,Ex2A (GCTCTACACAAGCTTCCTTTCC) and Ex2B (GGGCTGAACTTTCTGTGCTGG).

The PCR conditions were one cycle at 95°C (5 min); four cycles at 95°C (30 s) with the annealing temperature (Tann) = 72°C (30 s); four cycles with Tann = 68°C (30 s); four cycles with Tann = 66°C (30 s); four cycles with Tann = 64°C (30 s); four cycles with Tann = 62°C (30 s) ; and 30 cycles with Tann = 60°C . Dimethyl sulfoxide was added to the reaction mixture at 5%. Secondary PCR was carried out using 1 µl of the diluted (1:100) first fragments with primers Ex1A and Ex1B for exon 1, or Ex2A and Ex2B for exon 2 as templates, 2 pmol of each primer, 25 µM of deoxynucleotide triphosphates, 2 µCi of [alpha]-32PdCTP (Amersham, 3000 µCi/mmol), 10 mM Tris (pH 8.3), 50 mM KCL, 1.5 mM MgCl2 , 12% DMSO (dimethyl sulphoxide) and 0.125 of a unit of Taq polymerase (Perkin-Elmer Cetus) in a final volume of 5 µl. Primer sequences and annealing temperatures were taken from published data (11 ).

For exon 1, primersX1.31F (GGGAGCAGCATGGAGCCG) andX1.26R (AGTCGCCCGCCATCCCCT) were used.

Exon 2 was divided into three parts and amplified with overlapping sequences to increase the sensitivity of detection of mutations by SSCP.

For exon 2a,X2.62F (AGCTTCCTTCCGTCATGC) and286R (GCAGCACCACCAGCGTG);

for exon 2b,F200 (AGCCCAACTGCGCCGAC) and346R (CCAGGTCCACGGGCAGA);

and for exon 2c305F (TGGACGTGCGCGATGC) andX2.42R (GGAAGCTCTCAGGGTACAAATTC) were used as primers.

To analyze exon 3, the same conditions as for the secondary PCR for exons 1 and 2 were applied, except for application of genomic DNA as the PCR template instead of the PCR products, using primers X3.90F (CCGGTAGGGACGGCAAGAGA) and530R (CTGTAGGACCCTCGGTGACTGATGA). Thirty cycles were performed of: 1 min at 94°C, followed by 1 min at 63°C for exon 1, at 55°C for exon 2 and at 60°C for exon 3, and finally 1.5 min at 72°C. Forty-five µl of stop solution [95% formamide, 20 mM EDTA (ethylenediaminetetra-acetic acid), 0.05% bromophenol blue, 0.05% xylene cyanol] was then added to the reaction mixture and after heating at 80°C for 2 min, 1 µl aliquots of samples were loaded onto 5% polyacrylamide gels (acrylamide:bis ratio, 49:1) with or without 5% glycerol. Gels were run at 30 W with a water jacket at 25°C for 3 h before drying at 80°C and performance of autoradiography for 1-2 h.

To investigate the mRNA expression, the RT-PCR method was applied. Total RNA (1 µg) treated with RNase-free DNase was incubated with oligo d (T)20 primers and AMV reverse transcriptase at 60°C for 30 min. The 363 bp cDNA stretch corresponding to the first and second exons of p16 was amplified by primers p16U (GGGGTTCGGGTAGAGGAGGTG) and p16D (CATGGTTACTGCCTCTGGTG) with an RNA PCR kit (TaKaRa Co. Ltd., Otsu, Japan). The PCR conditions were the same as used for the exon 1 or 2 amplification. G3PDH expression was also examined as an internal control for RT-PCR with primers purchased from Clontech Laboratories, Inc. (Palo Alto, California, USA). Thirty cycles were performed at 94°C, 60°C, and 72°C for 1, 1, and 1.5 min, respectively. Reaction products for p16 and the corresponding G3PDH were placed into the same wells and separated on 1% agarose gels before staining with ethidium bromide for visualization.

Results

We investigated somatic mutations in all three exons of the p16 gene in 23 primary bladder carcinomas and the T24 bladder carcinoma cell line using the PCR-SSCP method. However, no mutations were detected in any of the tumors or the T24 cells (16 ). As a positive control, the pancreatic cell line ASPC-1 which has a mutation in exon 2 of the p16 gene was used. The presence of the mutation was confirmed (14 ). Representative photographs of the results of SSCP analysis for exons 1 and 2b (the middle part of exon 2) are shown in Fig. 1 .


Figure 1. PCR-SSCP analysis of exons 1 and 2b (the middle part of exon 2) of the p16 gene in human bladder carcinomas, as well as T24 and ASPC-1 cells. Note the abnormal mobility shift in the bands for ASPC-1 indicating a point mutation in exon 2, but its lack in the bladder carcinoma and T24 cases.

Decreased expression of the p16 gene relative to G3PDH was noted in nine cases (39%) out of the 23 (Case nos 2,5,7,11,13,14,19,20 and 23) examined and also in the T24 cell line by the RT-PCR method (Fig. 2 ).


Figure 2. mRNA expression of p16 and G3PDH in human bladder carcinomas, T24 and ASPC-1 cells revealed by RT-PCR. The upper bands correspond to G3PDH, and the lower bands to p16. In nine cases out of 23 (39%), decreased expression of p16 was observed relative to G3PDH (Case nos 2,5,7,11,13,14,19,20 and 23). M: DNA molecular weight markers, 123 bp DNA ladder (GibcoGRL, Life Technologies, Inc., Gaithersburg, MD, USA)

There were no histological differences apparent between cases with normal and decreased p16 expression.

Discussion

Although the mechanisms underlying development of bladder carcinogenesis remain unclear, several investigations have shown frequent gene alterations in the short arm of chromosome 9 in bladder carcinomas (1 -4 ). The p16 gene in this location is in fact a candidate putative tumor suppressor gene in many types of tumors, including bladder carcinomas and their derived cell lines, many carrying homozygous deletions (8 , 9 ). However, somatic mutations in the p16 gene may be rare except in hereditary melanomas, and in esophageal, pancreatic, and lung carcinomas (16 ,17 ). Our results are in agreement with the earlier reports of very low incidences of somatic mutations in primary bladder carcinomas (18 ,19 ). This is in clear contrast to the frequent occurrence of homozygous deletions (19 ,20 ).

Primary epithelial tumors always contain contaminating normal cells e.g. stromal cells, endothelial cells and lymphocytes, and therefore it may be very difficult to find homozygous deletions using a PCR based technique. In this study, we applied a nested primed PCR method to detect mutations in order to increase efficiency of the technique, and found that the p16 gene could be amplified from all samples. This is not, however, conclusive proof of lack of a homozygous deletion, given the possible generation of a p16 gene product from contaminating normal cells.

With regard to the apparent decrease in expression of the p16 gene in nine out of the 23 primary bladder carcinomas observed by RT-PCR, the cycle number was minimized in the present study, with only one round of PCR performed, and the level of p16 in normal cells is known to be generally low (21 -24 ). Therefore we believe that the signals observed were indeed from carcinoma as opposed to normal cells. The reasons for the decreased expression remain to be elucidated, but it could be due to methylation of the 5" CpG island of the p16 gene (25 ) or homozygous deletions of the gene (19 ,20 ). Whatever the reasons, the RT-PCR method described here is useful in detecting p16 gene abnormalities of any origin. Decreased expression of the p16 gene despite a lack of point mutations has also been reported for nasopharyngeal carcinomas (26 ) and high grade gliomas (27 ).

Loss of p16 function is very likely to cause deregulation of G1/S phases in the cell cycle. This abnormality could be expected to endow a growth advantage or stimulate more proliferation. We have also conducted a preliminary study of cell proliferating activity in bladder carcinomas with or without p16 expression by PCNA staining (data not shown). However, we could not detect any clear correlation between the two parameters, indicating that a pathway independent of p16 may exist to regulate the cell cycle.

References

1. Knowles MA, Elder PA, Williamson M, Cairns JP, Shaw ME, Law MG. Allelotype of human bladder cancer. Cancer Res 1994;54:531-8. MEDLINE Abstract

2. Orlow I, Lianes P, Lacombe L, Dalbagni G, Reuter VE, Cordon CC. Chromosome 9 allelic losses and microsatellite alterations in human bladder tumors. Cancer Res 1994;54:2848-51. MEDLINE Abstract

3. Cairns P, Shaw ME, Knowles MA. Preliminary mapping of the deleted region of chromosome 9 in bladder cancer. Cancer Res 1993;53:1230-1232. MEDLINE Abstract

4. Miyao N, Tsai YC, Lerner SP, Olumi AF, Spruck C3, Gonzalez ZM et al. Role of chromosome 9 in human bladder cancer. Cancer Res 1993;53:4066-70. MEDLINE Abstract

5. Cairns P, Tokino K, Eby Y, Sidransky D. Homozygous deletions of 9p21 in primary human bladder tumors detected by comparative multiplex polymerase chain reaction. Cancer Res 1994;54:1422-4. MEDLINE Abstract

6. Spruck C3, Ohneseit PF, Gonzalez ZM, Esrig D, Miyao N, Tsai YC et al. Two molecular pathways to transitional cell carcinoma of the bladder. Cancer Res 1994;54:784-8. MEDLINE Abstract

7. Sidransky D, Frost P, Von Eschenbach A, Oyasu R, Preisinger AC, Vogelstein B. Clonal origin of bladder cancer. N Eng J Med 1992;326:737-40. MEDLINE Abstract

8. Kamb A, Gruis NA, Weaver FJ, Liu Q, Harshman K, Tavtigian SV et al. A cell cycle regulator potentially involved in genesis of many tumor types. Science 1994;264:436-40. MEDLINE Abstract

9. Nobori T, Miura K, Wu DJ, Lois A, Takabayashi K, Carson DA. Deletions of the cyclin-dependent kinase-4 inhibitor gene in multiple human cancers. Nature 1994;368:753-6. MEDLINE Abstract

10. Serrano M, Hannon GJ, Beach D. A new regulatory motif in cell-cycle control causing specific inhibition of cyclin D/CDK4. Nature 1993;366:704-7. MEDLINE Abstract

11. Hussussian CJ, Struewing JP, Goldstein AM, Higgins PA, Ally DS, Sheahan MD et al. Germline p16 mutations in familial melanoma. Nat Genet 1994;8: 15-21. MEDLINE Abstract

12. Kamb A, Shattuck ED, Eeles R, Liu Q, Gruis NA, Ding W et al. Analysis of the p16 gene (CDKN2) as a candidate for the chromosome 9p melanoma susceptibility locus. Nat Genet 1994;8:23-6. MEDLINE Abstract

13. Mori T, Miura K, Aoki T, Nishihira T, Mori S, Nakamura Y. Frequent somatic mutation of the MTS1/CDK4I (multiple tumor suppressor/cyclin-dependent kinase 4 inhibitor) gene in esophageal squamous cell carcinoma. Cancer Res 1994;54:3396-7. MEDLINE Abstract

14. Caldas C, Hahn SA, da CL, Redston MS, Schutte M, Seymour AB et al. Frequent somatic mutations and homozygous deletions of the p16 (MTS1) gene in pancreatic adenocarcinoma. Nat Genet 1994;8:27-32. MEDLINE Abstract

15. Hayashi N, Sugimoto Y, Tsuchiya E, Ogawa M, Nakamura Y. Somatic mutations of the MTS (multiple tumor suppressor) 1/CDK4l (cyclin-dependent kinase-4 inhibitor) gene in human primary non-small cell lung carcinomas. Biochem Biophys Res Com 1994;202:1426-30. MEDLINE Abstract

16. Spruck C, Gonzalez ZM, Shibata A, Simoneau AR, Lin MF, Gonzales F et al. p16 gene in uncultured tumours. Nature 1994;370:183-4. MEDLINE Abstract

17. Cairns P, Mao L, Merlo A, Lee DJ, Schwab D, Eby Y et al. Rates of p16 (MTS1) mutations in primary tumors with 9p loss. Science 1994;265:415-7. MEDLINE Abstract

18. Kai M, Arakawa H, Sugimoto Y, Murata Y, Ogawa M, Nakamura Y. Infrequent somatic mutation of the MTS1 gene in primary bladder carcinomas. Jpn J Cancer Res 1995;86:249-51. MEDLINE Abstract

19. Orlow I, Lacombe L, Hannon GJ, Serrano M, Pellicer I, Dalbagni G et al. Deletion of the p16 and p15 genes in human bladder tumors. J Nat Cancer Inst 1995;87:1524-9. MEDLINE Abstract

20. Cairns P, Polascik TJ, Eby Y, Tokino K, Califano J, Merlo A et al. Frequency of homozygous deletion at p16/CDKN2 in primary human tumours. Nat Genet 1995;11:210-2. MEDLINE Abstract

21. Jen J, Harper JW, Bigner SH, Bigner DD, Papadopoulos N, Markowitz S et al. Deletion of p16 and p15 genes in brain tumors. Cancer Res 1994;54:6353-8. MEDLINE Abstract

22. Shapiro GI, Edwards CD, Kobzik L, Godleski J, Richards W, Sugarbaker DJ et al. Reciprocal Rb inactivation and p16INK4 expression in primary lung cancers and cell lines. Cancer Res 1995;55:505-9. MEDLINE Abstract

23. Tam SW, Shay JW, Pagano M. Differential expression and cell cycle regulation of the cyclin-dependent kinase 4 inhibitor p16Ink4. Cancer Res 1994;54:5816-20. MEDLINE Abstract

24. Geradts J, Kratzke RA, Niehans GA, Lincoln CE. Immunohistochemical detection of the cyclin-dependent kinase inhibitor 2/multiple tumor suppressor gene 1 (CDKN2/MTS1) product p16INK4A in archival human solid tumors: correlation with retinoblastoma protein expression. Cancer Res 1995;55:6006-11. MEDLINE Abstract

25. Merlo A, Herman JG, Mao L, Lee DJ, Gabrielson E, Burger PC et al. 5' CpG island methylation is associated with transcriptional silencing of the tumour suppressor p16/CDKN2/MTS1 in human cancers. Nat Medicine 1995;1: 686-92. MEDLINE Abstract

26. Sun Y, Hildesheim A, Lanier AE, Cao Y, Yao KT, Raab-Traub N et al. No point mutation but decreased expression of the p16/MTS1 tumor suppressor gene in nasopharyngeal carcinomas. Oncogene 1995;10:785-8. MEDLINE Abstract

27. Nishikawa R, Furnari FB, Lin H, Arap W, Berger MS, Cavenee WK et al. Loss of p16INK4 expression is frequent in high grade glioma. Cancer Res 1995;55: 1941-5. MEDLINE Abstract


Received July 4, 1996; accepted September 12, 1996
For reprints and all correspondence: Makoto Asamoto, Chemotherapy Division, National Cancer Center Research Institute, 1-1,Tsukiji 5-chome, Chuo-ku, Tokyo 104, Japan
Abbreviations: LOH, Loss of heterozygosity; PCR, polymerase chain reaction; SSCP, single strand conformation polymorphism; RT, reverse transcriptase


This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 19 May 1998
Copyright© Japanese Journal of Clinical Oncology, 1997.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
E. J. Chapman, P. Harnden, P. Chambers, C. Johnston, and M. A. Knowles
Comprehensive Analysis of CDKN2A Status in Microdissected Urothelial Cell Carcinoma Reveals Potential Haploinsufficiency, a High Frequency of Homozygous Co-deletion and Associations with Clinical Phenotype
Clin. Cancer Res., August 15, 2005; 11(16): 5740 - 5747.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrow Request Permissions
Google Scholar
Right arrow Articles by Asamoto, M
Right arrow Articles by Tsuda, H
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Asamoto, M
Right arrow Articles by Tsuda, H
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?