Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (26)
Right arrow Request Permissions
Google Scholar
Right arrow Articles by Fujita, S.
Right arrow Articles by Sugano, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fujita, S.
Right arrow Articles by Sugano, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Japanese Journal of Clinical Oncology Pages 378-383


Expression of c-met Proto-oncogene in Primary Colorectal Cancer and Liver Metastases
Introduction
Materials And Methods
   Tissues
   RT-PCR
   Control Plasmids
   Electrophoresis
   Statistical Analysis
Results
   Quantification of c-met and [beta]-actin Control Plasmids
   c-met Expression in Colorectal Cancer and Liver Metastasis Tissue
Discussion
Acknowledgments
References

Expression of c-met Proto-oncogene in Primary Colorectal Cancer and Liver Metastases

Expression of c- met Proto-oncogene in Primary Colorectal Cancer and Liver Metastases Shin Fujita1 and Kokichi Sugano2

1Department of Surgery, 2Division of Clinical Laboratory, National Cancer Center Hospital, Tokyo, Japan

We have examined the expression of c-met mRNA in tissue from 27 colorectal cancers and ten liver metastases using the reverse transcriptase-polymerase chain reaction method. The expression of c-met mRNA in these tissues was quantified and the copy number of c-met mRNA to 108.0 copies of [beta]-actin mRNA was calculated. Mean copy numbers of c-met mRNA in cancer tissue and normal mucosa were 105.5 and 104.5 respectively. The c-met expression of cancer was significantly higher than that of normal mucosa (P < 0.0001). In 20 of 22 samples in which c-met expression of both tumor and corresponding normal tissue were examined, c-met was overexpressed in the cancer tissue. No correlation was found between c-met expression and the clinicopathologic background. The mean copy numbers of c-met mRNA in the tissue from the ten liver metastases and normal liver were 106.1 and 106.2 respectively. Although c-met expression in metastatic tissue was higher than that in the primary cancer tissue, the increase was not statistically significant. In three of four patients with synchronous liver metastases, c-met was overexpressed in the metastatic tissue compared with that in the corresponding primary cancer tissue. These results show that c-met is overexpressed in both primary colorectal cancer and liver metastases and suggest that c-met plays a role in the development of colorectal cancer liver metastases.

Key words: c-met - colorectal cancer - liver metastasis - hepatocyte growth factor - reverse transcriptase-polymerase chain reaction

INTRODUCTION

Liver metastasis is one of the critical prognostic factors of colorectal cancer and 25% of patients with colorectal cancer have synchronous or metachronous liver metastases. An understanding of the mechanisms causing such liver metastases is therefore essential for ensuring that they are appropriately treated and followed-up.

The product of the c-met proto-oncogene encodes transmembrane tyrosine kinase (1 ) and is the receptor for hepatocyte growth factor (HGF), which regulates both cell motility and cell growth (2 ). c-met is expressed in various normal tissues (3 ) and overexpressed in tumors, including thyroid (4 ), stomach (5 ), pancreatic (6 ,7 ) and colon cancer (8 ,9 ). HGF is detected around the tumors, including liver metastases (10 ). These facts suggest that c-met and HGF play an important role in invasion and metastasis.

Overexpression of c-met in primary colorectal cancer and liver metastases has been reported using Northern blot (9 ). However, it is difficult to quantify mRNA in small clinical samples using Northern blot. We have therefore quantified mRNA expression of c-met in colorectal cancer and liver metastatic tissues by quantitative reverse transcriptase polymerase chain reaction (RT-PCR) using fluorescence-labeled primers and autosequencer and examined the relationship between c-met expression and liver metastasis.

MATERIALS AND METHODS

Tissues

Tumor, adjacent normal mucosa (10 cm away from the tumor), liver metastatic tumor and normal liver tissue from patients with colorectal cancer at the National Cancer Center Hospital were obtained immediately after surgery and frozen and stored in liquid nitrogen. To avoid liver tissue contamination, the metastatic tissues were carefully taken from the periphery of the metastases adjacent to the central necrosis.

RT-PCR

Total RNA was extracted from the frozen tissues by the procedure described by Chomcznski and Sacchi (11 ). Randomly primed cDNA was synthesized from 1 µg of total RNA by reverse transcriptase (GIBCO BRL, Gaithersburg, MD, USA) in a total volume of 20 µl and followed by PCR amplification. c-met and [beta]-actin cDNA were amplified using the following primers: c-met (12 ), 5'TGCGAAGTGAAGGGTCTCC3', 5'GGTCACTTCACCTACCGAAA3' (reverse primer); [beta]-actin (13 ), 5'CTGTCTGGCGGCACCACCAT3' (forward primer), 5'GCAACTAAGTCA- TAGTCCGC3' (reverse primer). Forward primers were synthesized and labeled with Cy5 amidyte reagent, a fluorescent dye (Pharmacia, Uppsala, Sweden), using Oligo 1000 DNA synthesizer (Beckman, Fullenton, CA, USA). The reaction mixture contained 5 µl of cDNA as a template, 25 pmol of forward and reverse primers of c-met and [beta]-actin, 20 nmol each dNTP, 10 mM Tris/HCl pH 8.3, 50 mM potassium chloride, 1.5 mM magnesium chloride, 0.001% (w/v) gelatin and 2.5 units of Taq DNA polymerase (Perkin Elmer Cetus, Norwalk, CT, USA) to a total volume of 100 µl. The PCR amplification was performed for 30 cycles in the following conditions: denatured at 94°C for 30 s, annealed at 54°C for 30 s, extended at 72°C for 30 s.


Figure 1. Quantification of c-met and [beta]-actin control plasmids. Serially diluted c-met (A) and [beta]-actin control plasmids (B) were analyzed. The vertical and horizontal axes are fluorescence intensity and electrophoresis time respectively. The areas under the peaks (peak area) were calculated by the software Fragment ManagerTM and plotted in the insets. 105-108 copies of c-met mRNA and 106-109 copies of [beta]-actin mRNA could be quantified.

Control Plasmids

The PCR products containing c-met or [beta]-actin were subcloned into the pUC18 plasmid vector (Pharmacia) and JM109 competent cells (Toyobo, Osaka, Japan) were transformed by this plasmid according to the manufacturer's instructions. The transformed cells were cultured in LB agar (Wako Pure Chemical Co., Osaka, Japan). Plasmids were purified using a Quiagen plasmid kit (Quiagen, Chatsworth, CA, USA) and were used as a control. It was estimated that 1 µg of the plasmids contained cDNA derived from 6.8×1011 copies of c-met or [beta]-actin mRNA.

Electrophoresis

Two microliters of the PCR products were mixed with 5 µl of the loading buffer containing 90% deionized formamide, 20 mM EDTA and 0.05% bromophenol blue; 1.5 µl of the aliquot was electrophoresed on 6% polyacrylamide gel containing 6M urea at 35W and 55°C for 150 min using ALFred DNA sequencer (Pharmacia). Data were analyzed using the software package Fragment ManagerTM (Pharmacia) equipped with short gel plate (14 ).

Statistical Analysis

Estimated mRNA expression was statistically compared by unpaired t-test.


Figure 2. Expression of c-met and [beta]-actin in cancer tissues and corresponding normal mucosa. Electrophoresis pattern of RT-PCR products of patient 8. (A) c-met and (B) [beta]-actin curves. c-met in cancer tissue was overexpressed compared with that in corresponding normal mucosa, but both showed the same level of [beta]-actin expression. T, tumor; N, normal mucosa.

RESULTS

Quantification of c-met and [beta]-actin Control Plasmids

Serially diluted c-met and [beta]-actin control plasmids were analyzed and 105-108 copies of c-met mRNA and 106-109 copies of [beta]-actin mRNA could be quantified by this PCR (Fig. 1 ). Two peaks of [beta]-actin control plasmids were beyond the scale in this condition. However, these peaks were also usable for quantification because plots of the area under the peaks were on a linear curve.

c-met Expression in Colorectal Cancer and Liver Metastasis Tissue

c-met and [beta]-actin mRNA were examined in tissue from 27 cases of primary colorectal cancer and ten cases of liver metastases (Fig. 2 ). After estimating the copy number of c-met and [beta]-actin mRNA using the control plasmids as a standard, the copy number of c-met mRNA was standardized by the following formula: estimated copy number of c-met mRNA * 108/estimated copy number of [beta]-actin mRNA. This gives numbers of c-met mRNA to 108 copies of [beta]-actin mRNA. The patients' backgrounds and standardized c-met expression are summarized in Table 1 . Mean copy numbers of c-met mRNA in cancer tissues and normal mucosa were 105.5 and 104.5 respectively (Fig. 3 ). The copy number of c-met mRNA in cancer was significantly higher than that of normal mucosa (P < 0.0001). The expression of c-met mRNA in cancer tissue could be compared with that of corresponding normal tissue in 22 of the 27 samples. In 20 of the 22 (91%), c-met was overexpressed in the cancer tissue when compared with its expression in corresponding normal tissue. No correlation was found between c-met expression and Dukes' stage.

Table 1. Clinicopathological backgrounds and c-met expression
Patient
No.
Tumor*
location
Histological
grade
Dukes'
stage
Standardized copy number
of c-met m-RNA[dagger]
Primary
tumor
Normal
mucosa
Liver
mets
Normal
liver
1 S Moderate B 4.8 4.1
2 R Well B 5.8 5.7
3 S Moderate C 5.9 4.2
4 R Well A 6.9 4.2
5 S Moderate C 2.9 3.5
6 R Moderate B 5.4 3.2
7 A Well B 5.7 4.3
8 R Well B 6.9 5.8
9 C Well B 6.6 5.1
10 A Poor C 6.7 4.3
11 S Moderate B 6.0 4.3
12 R Moderate A 4.5 4.3
13 R Moderate C 4.7 5.8
14 S Moderate C 6.8 5.3
15 S Well B 4.7 3.1
16 R Well B 5.1 -[Dagger]
17 S Well C 5.8 -
18 R Moderate C 4.6 -
19 A Well B 5.8 5.5
20 A Moderate C 4.6 5.5
21 D Moderate D 5.9 4.6
22 A Well C 5.7 4.7
23 S Moderate D 6.1 - 6.2 -
24 S Well D 5.7 4.9 6.4 6.6
25 R Well D 7.1 5.5 5.9 6.7
26 R Moderate D 3.7 - 5.0 -
27 S Well D 4.5 3.7 - 6.3
28§ R Moderate A 5.4 6.8
29 T Moderate D 6.5 6.7
30 D Mucinous C 6.8 5.8
31 R Moderate C 5.3 6.6
32 S Moderate C 6.1 4.4
33 C Well C 7.0 7.0
*C, cecum; A, ascending colon; T, trasverse colon; D, descending colon; S, sigmoid colon; R, rectum; [dagger]the number is log10(standardized copy number of c-met mRNA); [Dagger]c-met or [beta]-actin was not amplified by RT-PCR; §Patients nos 28-33 had metachronous liver metastases. Dukes' stage of these patients are primary cancer stage.


Figure 3. c-met expression in tissue from colorectal cancer and liver metastases. Mean copy numbers of c-met mRNA in cancer tissue, normal colon mucosa, metastatic tissue and normal liver were 105.5, 104.5, 106.1 and 106.2 respectively. The horizontal and vertical bars are the mean and standard deviation respectively. N, normal mucosa; T, tumor; M, liver metastasis; L, normal liver.

c-met expression was also examined in liver metastatic tissue and normal liver from ten cases. The mean copy numbers of c-met mRNA in the metastatic tissue and normal liver were 106.1 and 106.2 respectively. These copy numbers in metastatic tissue and normal liver were significantly higher than those in normal mucosa (P < 0.0001). c-met expression of metastatic tissue was also higher than that of the primary tumor. However, the difference was not significant. Expression of c-met mRNA in the primary tumor and corresponding metastatic tissue was compared in four patients with synchronous liver metastases. In three of the four cases (75%), c-met was overexpressed in the metastatic tumor when compared with its expression in the corresponding primary tumor.

DISCUSSION

Our results show that c-met is expressed more strongly in primary colorectal cancer than in normal mucosa and that c-met expression in liver metastases is higher than that in the corresponding primary cancer. A melanoma cell line that produces liver-specific metastases in a murine metastasis model has a higher level of c-met than other melanoma cell lines and c-met expression correlates with their liver colonization potential (15 ). Increased c-met expression in transformed cells enhances their invasiveness and metastatic potential (16 ). These facts suggest that the overexpression of c-met in primary cancer and metastatic tissue gives colorectal cancer cells an advantage to colonize the liver.

c-met is overexpressed in thyroid (4 ), stomach (5 ), pancreatic (6 ,7 ) and colon cancers (8 ,9 ). Di Renzo et al. showed c-met overexpression in >50% of colorectal tumors including adenomas and a lack of correlation between the c-met overexpresion and tumor stage (9 ). Our results indicate that c-met is overexpressed in >90% of cancers and that there is no relationship between c-met expression and tumor stage.

The increased expression of c-met is explained by a transcriptional level change and gene amplification of c-met. The transcription of c-met is upregulated by cytokines such as interleukin (IL)-1, IL-6, tumor necrosis factor-[alpha] (17 ) and HGF (18 ). Since these cytokines are induced around the tumors, they are thought to increase c-met expression in the tumor. Loss of wild-type p53 also enhances the opportunity for inappropriate c-met expression (19 ). Point mutation of p53 and loss of heterozygosity (LOH) of chromosome 17p are frequently detected in colorectal cancer and the rates of p53 mutation and LOH of 17p are higher in liver metastatic tumors than primary tumors (20 ). Gene amplification of c-met has been detected in gastric and colorectal cancer (9 ,21 ). In colorectal cancer, gene amplification has been detected in 10% of primary cancers and in eight of nine (88%) liver metastases (9 ).

The ligand of c-met, HGF, increases the motility of several normal cell types and cancer cells including colon cancer (22 ). Immunohistochemical analysis has shown that HGF is undetectable in normal liver but is present in liver around tumor metastases (10 ). The serum HGF concentration is increased in certain clinical conditions such as liver failure, cirrhosis (23 ), transcatheter arterial embolization, partial hepatectomy (24 ) and abdominal surgery (25 ). These facts show that HGF production results from cancer cell invasion into the liver, inflammation or surgery and they suggest that HGF activates overexpressed c-met in colorectal cancer and stimulates invasion and metastasis. Transformed NIH 3T3 cells that secrete HGF and express c-met acquire tumorigenecity in nude mice and develop metastatic activity (16 ). This suggests that an interaction between HGF and c-met plays an important role in tumorigenesis. In this case, HGF and c-met work as an autocrine system. However, HGF is not detected in normal liver and the liver metastases of colorectal cancer. As HGF is detected around liver metastases, it serves a paracrine-like role in the development of colorectal cancer liver metastases. HGF is also a potent cell growth stimulator of hepatocytes (26 ), pancreatic cells (27 ) and endothelial cells (28 ,29 ). It therefore acts as an angiogenic factor and induces the development of blood vessels around the metastatic tumor. This angiogenic function has also been thought to stimulate the development of liver metastases. On the other hand, HGF inhibits the cell growth of various tumor cell lines including hepatoma (30 ,31 ) and colon cancer cells (22 ). This indicates that c-met overexpression is undesirable for cancer growth. However, the growth inhibition rate of HGF varies among colon cancer cells and the inhibition is not marked (22 ). These differences in effect of HGF on colon cancer cells may correlate with the growth rate of colorectal cancer liver metastases.

In conclusion, c-met is overexpressed in primary colorectal cancer and liver metastases and c-met mRNA is higher in liver metastases than in primary cancer. These facts suggest that c-met plays a role in the development of colorectal cancer liver metastases.

Acknowledgments

This work was supported in part by a Grant-in-Aid for the Second Term Comprehensive 10-year Strategy for Cancer Control from the Ministry of Health and Welfare of Japan and by a Grant-in-Aid from Foundation for Promotion of Cancer Research. We thank N. Fukayama for technical assistance.

References

1 Dean M, Park M, Beau MML, Robins TS, Diaz MO, Rowley JD, et al. The human met oncogene is related to the tyrosine kinase oncogenes. Nature 1985;318:385-8. MEDLINE Abstract

2 Gherardi E, Stoker M. Hepatocyte growth factor-scatter factor: mitogen, motogen and met. Cancer Cells 1991;3:227-32. MEDLINE Abstract

3 Iler A, Kmiecik TE, Park M, Daar I, Blair D, Dunn KJ et al. Structure, tissue-specific expression and transforming activity of the mouse met protooncogene. Cell Growth Diff 1990;1:87-95.

4 Di Renzo MF, Olivero M, Ferro S, Prat M, Bongarzone I, Pilotti S, et al. Overexpression of c-MET/HGF receptor gene in human thyroid carcinomas. Oncogene 1992;7:2549-53. MEDLINE Abstract

5 Kuniyasu H, Yasui W, Yokozaki H, Kitadai Y, Tahara E. Aberrant expression of c-met mRNA in human gastric carcinomas. Int J Cancer 1993;55:72-5. MEDLINE Abstract

6 Ebert M, Yokoyama M, Friess H, Büchler MW, Korc M. Coexpression of the c-met proto-oncogene and hepatocyte growth factor in human pancreatic cancer. Cancer Res 1994;54:5775-8. MEDLINE Abstract

7 Di Renzo MF, Poulson R, Olivero M, Comoglio PM, Lemoine NR. Expression of the met/hepatocyte growth factor receptor in human pancreatic cancer. Cancer Res 1995;55:1129-38. MEDLINE Abstract

8 Liu C, Park M, Tsao MS. Overexpression of c-met proto-oncogene but not epidermal growth factor receptor or c-erbB-2 in primary human colorectal carcinomas. Oncogene 1992;7:181-5. MEDLINE Abstract

9 Di Renzo MF, Olivero M, Giacomini A, Porte H, Chastre E, Mirossay L, et al. Overexpression and amplification of the Met/HGF receptor gene during the progression of colorectal cancer. Clin Cancer Res 1995;1:147-54.

10 Yoshinaga Y, Matsuno Y, Fujita S, Nakamura T, Kikuchi M, Shimosato Y, et al. Immunohistochemical detection of hepatocyte growth factor/scatter factor in human cancerous and inflammatory lesions of various organs. Jpn J Cancer Res 1993;84:1150-8. MEDLINE Abstract

11 Chomczynski P, Sacchi N. Single-step of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156-9. MEDLINE Abstract

12 Park M, Dean M, Kaul K, Braun MJ, Gonda MA, Vande Wound GF. Sequence of MET protooncogene cDNA has features characteristic of the tyrosine kinase family of growth-factor receptors. Proc Natl Acad Sci USA 1987;84:6379-83. MEDLINE Abstract

13 Nakajima-Iijima S, Hamad H, Reddy P, Kakunaga T. Molecular structure of the human cytoplasmic [beta]-actin gene: interspecies homology of sequences in the introns. Proc Natl Acad Sci USA 1985;82:6133-7. MEDLINE Abstract

14 Maekawa M, Sugano K, Ushiama M, Masuda T, Ohkura H, Kakizoe T, et al. Relative ratios of mRNA molecules encoded by genes with homologous sequences using fluorescence-based single strand conformation polmorphism analysis. Biochem Biophys Res Comm 1996;223:520-5. MEDLINE Abstract

15 Rusciano D, Lorenzoni P, Burger MM. Murine models of liver metastasis. Invasion Metastasis 1995;14:349-61.

16 Rong S, Segal S, Anver N, Resau JH, Vande Woude GF. Invasiveness and metastasis of NIH 3T3 cells induced by Met-hepatocyte growth factor/scatter factor autocrine stimulation. Proc Natl Acad Sci USA 1994;91:4731-5. MEDLINE Abstract

17 Moghul A, Lin L, Beedle A, Kanbour-Shakir A, DeFrances MC, Liu Y, et al. Modulation of c-MET protooncogene (HGF receptor) mRNA abundance by cytokines and hormones: evidence for rapid decay of the 8kb c-MET transcript. Oncogene 1994;9:2045-52. MEDLINE Abstract

18 Boccaccio C, Gaudino G, Gambarotta G, Galimi F, Comoglio PM. Hepatocyte growth factor (HGF receptor) is inducible and is part of the delayed-early response to HGF. J Biol Chem 1994;269:12846-51. MEDLINE Abstract

19 Rong S, Donehower LA, Hansen MF, Strong L, Tainsky M, Jeffers M, et al. Met proto-oncogene product is overexpressed in tumors of p53-deficient mice and tumors of Li-fraumeni patients. Cancer Res 1995;55:1963-70. MEDLINE Abstract

20 Goh HS, Chan CS, Khine K, Smith DR. p53 and behavior of colorectal cancer. Lancet 1994;344:233-4. MEDLINE Abstract

21 Kuniyasu H, Yasui W, Kitadai Y, Yokozaki H, Ito H, Tahara E. Frequent amplification of the c-met gene in scirrhous type stomach cancer. Biochem Biophys Res Comm 1992;189:227-32. MEDLINE Abstract

22 Jiang WG, Lloyds D, Puntis MCA, Nakamura T, Hallett MB. Regulation of spreading and growth of colon cancer cells by hepatocyte growth factor. Clin Exp Metastasis 1993;11:235-42. MEDLINE Abstract

23 Gohda E, Tsubouchi H, Nakayama H, Hirona S, Sakiyama O, Takahashi K, et al. Purification and partial characterization of hepatocyte growth factor from plasma of a patient with fulminant hepatic failure. J Clin Invest 1988;81:414-9. MEDLINE Abstract

24 Kaneko A, Hayashi N, Tanaka Y, Ito T, Kasahara A, Kubo M et al. Changes in serum human hepatocyte growth factor levels after transcatheter arterial embolization and partial hepatectomy. Am J Gastroenterol 1992;87:1014-7. MEDLINE Abstract

25 Tomiya T, Tani M, Yamada S, Hayashi S, Umeda N, Fujiwara K. Serum hepatocyte growth factor levels in hepatectomized and nonhepatectomized surgical patients. Gastroenterol 1992;103:1621-4.

26 Nakamura T, Nawa K, Ichihara A. Partial purification and characterization of hepatocyte growth factor from serum of hepatectomized rats. Biochem Biophys Res Comm 1984;122:1450-59. MEDLINE Abstract

27 Vila MR, Nakamura T, Real F. Hepatocyte growth factor is a potent mitogen for normal human pancreas cells in vitro. Lab Invest 1995;73:409-18. MEDLINE Abstract

28 Rosen EM, Meromsky L, Setter E, Vinter DW, Goldberg ID. Purified scatter factor stimulates epithelial and vascular endothelial cell migration. Proc Soc Exp Biol Med 1990;195:34-43. MEDLINE Abstract

29 Morimoto A, Okamura K, Hamanaka R, Sato Y, Shima N, Higashio K, et al. Hepatocyte growth factor modulates migration and proliferation of human microvascular endothelial cells in culture. Biochem Biophys Res Comm 1991;179:1042-9. MEDLINE Abstract

30 Tajima H, Matsumoto K, Nakamura T. Hepatocyte growth factor has potent anti-proliferative activity in various tumor cell lines. FEBS Lett 1991;391:229-32.

31 Shiota G, Rhoads DB, Wang TC, Nakamura T, Schmidt EV. Hepatocyte growth factor inhibits growth of hepatocellular carcinoma cells. Proc Natl Acad Sci USA 1992;89:373-7. MEDLINE Abstract


Received March 27, 1997; accepted June 18, 1997
For reprints and all correspondence: Shin Fujita, Department of Surgery, National Cancer Center Hospital, 1-1, Tsukiji 5-chome, Chuo-ku, Tokyo 104, Japan
Abbreviations: RT-PCR, reverse transcriptase-polymerase chain reaction; HGF, hepatocyte growth factor; IL, interleukin; LOH, loss of heterozygosity.


This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 19 May 1998
Copyright© Japanese Journal of Clinical Oncology, 1997.

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 19 May 1998
Copyright© Japanese Journal of Clinical Oncology, 1997.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
H. Takeuchi, A. Bilchik, S. Saha, R. Turner, D. Wiese, M. Tanaka, C. Kuo, H.-J. Wang, and D. S. B. Hoon
c-MET Expression Level in Primary Colon Cancer: A Predictor of Tumor Invasion and Lymph Node Metastases
Clin. Cancer Res., April 1, 2003; 9(4): 1480 - 1488.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (26)
Right arrow Request Permissions
Google Scholar
Right arrow Articles by Fujita, S.
Right arrow Articles by Sugano, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fujita, S.
Right arrow Articles by Sugano, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?