| Japanese Journal of Clinical Oncology | Pages |
Microsatellite Instability is Associated with the Macroscopic Configuration of Neoplasms in Patients with Multiple Colorectal Adenomas
Introduction
Materials And Methods
Results
Discussion
Acknowledgment
References
Microsatellite Instability is Associated with the Macroscopic Configuration of Neoplasms in Patients with Multiple Colorectal Adenomas
Methods: For a total of 19 adenomas and four carcinomas from four patients with multiple colorectal adenomas, we analyzed genetic instability at four selected microsatellite loci and screened exon 1-4 of the APC gene with special reference to macroscopic configurations of adenomas and carcinomas.
Results: RER-positive phenotypes were detected in none of 13 protruded type adenomas, two (33%) out of six superficial elevated type adenomas and two (50%) out of four carcinomas. We detected no mutation of exon 1-4 of the APC gene in any sample. In patients with multiple colorectral adenomas, the proportion of superficial elevated type adenomas exhibiting genetic instability was significantly higher than that of protruded type adenomas.
Conclusions: The results suggested that RER-positive phenotype was an early event in tumorigenesis through superficial elevated type adenomas.
INTRODUCTION
Familial adenomatous polyposis (FAP) is an autosomal dominant inherited disease characterized by the development of more than 100 adenomas in the colorectum. Because most FAP patients develop colorectal carcinomas in their forties if left untreated, prophylactic surgery is recommended once a definite diagnosis has been made. Restorative proctocolectomy and pouch-anal anastomosis are the operations of choice for FAP patients (1-4). FAP patients already carry germline mutations of the APC gene at 5q21-22 and acquire inactivation of both alleles of this gene by somatic loss of the other normal allele (5-7). Therefore, the identification of APC gene mutation is now considered a prerequisite in the management of FAP patients.
On the other hand, patients with multiple colorectal adenomas, less than 100 in number, are assumed to be heterogeneous in clinical characteristics and patient management has not been well documented. Some of them are classified as an attenuated form of adenomatous polyposis coli (AAPC) (8,9). AAPC is characterized by a small number of colorectal adenomas, usually fewer than 100, and by later onset of colorectal carcinomas than in ordinary FAP (10). Spirio and co-workers (8,9,11) reported that mutations involving the 5[prime] end of the APC gene, especially exon 3 and 4, are associated with AAPC. Others are classified as hereditary flat adenoma syndrome (HFAS) (12). Lynch et al. reported clinical features of multiple flat adenomas in hereditary nonpolyposis colorectal carcinomas (HNPCC) and defined this syndrome as a subgroup of HNPCC, named HFAS. Because more than 90% of tumors from HNPCC patients exhibit genetic instability phenotypes at microsatellite loci, replication error (RER) is used as one of the hallmarks of candidate HNPCC (13,14). Furthermore, Watanabe et al. (15) reported that flat adenomas were important as a precursor of colorectal carcinoma in HNPCC and that they very frequently exhibited genetic instability.
Table 1.
| Exon | Sense (5[prime]->3[prime]) | Antisense (5[prime]->3[prime]) | Length (bp) |
| 1 | AATTCTTCTTAAACTGCTTAAGAG | TTTACAAGAGGGAATACTGAAT | 326 |
| 2 | TCAAGAAATACAGAATCACGTC | TGTACTTGGATCTACACACC | 232 |
| 3 | CATTAAGAATATTTTAGACTGCT | TAACAATAAACTGGAGTACACA | 312 |
| 4 | CAACTGATGTAAGTATTGCTC | TTTAATGGATTACCTAGGTACT | 258 |
Table 2.
| Patient | Age/gender | Family history | RER | Tumor | Location | Configuration | Size (mm) | D2S123 | D3S1067 | D5S644 | TP53 |
| 1 | 63/M | + | - | Adenoma | A | I p | 10 | - | - | - | - |
| brother | - | Adenoma | A | I p | 5 | - | - | - | - | ||
| colon ca. | - | Adenoma | A | I p | 10 | - | - | - | - | ||
| (66 y.o.) | - | Adenoma | T | I p | 25 | - | - | - | - | ||
| - | Adenoma | T | I p | 15 | - | - | - | - | |||
| + | Carcinoma | D | Type 2 | 75 | - | + | + | - | |||
| 2 | 64/M | - | - | Adenoma | A | II a | 9 | - | - | - | - |
| - | Adenoma | A | II a | 20 | - | - | - | - | |||
| - | Adenoma | T | II a | 20 | - | - | - | - | |||
| + | Adenoma | T | II a | 15 | - | - | + | + | |||
| + | Adenoma | T | II a | 8 | - | - | + | + | |||
| + | Carcinoma | S | I p | 12 | - | - | + | - | |||
| 3 | 54/M | + | - | Adenoma | A | I s | 3 | - | - | - | - |
| mother | - | Adenoma | A | I s | 2 | - | - | - | - | ||
| rectal ca. | - | Adenoma | A | I s | 3 | - | - | - | - | ||
| (fifties) | - | Adenoma | T | I s | 3 | - | - | - | - | ||
| - | Adenoma | D | I s | 5 | - | - | - | - | |||
| - | Adenoma | D | II a | 3 | - | - | - | - | |||
| - | Carcinoma | T | II a + II c | 17 | - | - | - | - | |||
| - | Carcinoma | S | Type 2 | 27 | - | - | - | - | |||
| 4 | 46/M | + | - | Adenoma | D | I p | 14 | - | - | - | - |
| grandmother | - | Adenoma | S | I sp | 10 | - | - | - | - | ||
| gastric ca. | - | Adenoma | R | I sp | 7 | - | - | - | - |
To establish reasonable management of patients with multiple colorectal adenomas, 10-100 in number, the genetic backgrounds of these patients should be made clear. We have therefore carried out a molecular analysis for such patients with special reference to macroscopic configurations of adenomas and carcinomas.
MATERIALS AND METHODS
A total of 19 adenomas and four carcinomas were collected from four patients with multiple colorectal adenomas at the University of Tokyo and Tokyo Hitachi Hospital from January to July 1997. All samples were obtained endoscopically and macroscopic configurations were classified according to the Rules of the Japanese Society for Cancer of the Colon and Rectum (16). Procedures for isolation and purification of DNA samples were as already described (17).
For all samples, we analyzed genetic instability at four selected microsatellite loci, D2S123, D3S1067, D5S644 and TP53. Primer sets for these loci were used as described elsewhere (18-21). Polymerase chain reaction (PCR) was performed as described previously (22).
We screened exon 1-4 of the APC gene in all DNAs, using the PCR-single strand conformation polymorphism (SSCP) method. Primer sets used in this study are listed in Table 1. All primers were designed within intronic sequences flanking exons. SSCP was performed as described by Glavac and Dean (23) with some modification. In brief, each 5 µl of reaction mixture contained 20 ng of DNA, 25 µM of dNTPs, 0.08 unit of Taq DNA polymerase, 83 nM of each oligonucleotide in 10 mM Tris (pH 8.8), 50 mM KCl, 5.1 mM MgCl2 and 0.1 µl of [[gamma]-32P]dATP (Amersham, 5000 Ci/mmol). Thirty-five cycles of 94, 55 and 72°C for 0.5, 0.5 and 1 min, respectively, were run in a thermocycler (Perkin-Elmer Cetus 9600). After PCR, 3 µl of each reaction mixture were mixed with 10 µl of loading buffer (95% formamide, 20 mM EDTA, 0.05% bromophenol blue and 0.05% xylene cyanol). The samples were heated at 90°C for 5 min and then quickly cooled on ice. A 3 µl volume of each mixture was applied to 5% polyacrylamide gel (acrylamide/bis-acrylamide ratio = 19:1) containing 50 mM Tris-borate, pH 8.3, 4 mM EDTA and 5% glycerol. Electrophoresis was carried out with a sequencing gel apparatus at 300 V for 6-8 h (16°C). After electrophoresis, the gels were dried and autoradiographed for 6-8 h at room temperature on Fuji film.
The [chi]2 test was used to analyze differences in genetic instability among different macroscopic configurations.
RESULTS
Among 19 adenomas, macroscopic configurations were classified as protruded type in 13 and superficial elevated type in 6. Thirteen protruded type adenomas were subdivided into I s in five, I sp in two and I p in six. All superficial elevated type adenomas were II a in morphological appearance. Among the four carcinomas collected in this study, two were early carcinomas and the remaining two were advanced carcinomas. One of the early carcinomas was classified as II a + II c and the other as I p. Both of the advanced carcinomas were classified as type 2 (Table 2).
The RER test revealed that none of the protruded type adenomas exhibited genetic instability phenotype; however, one-third of the superficial elevated type adenomas exhibited genetic instability phenotype (Tables 2 and 3). The macroscopic picture and positive gel pattern in the RER test of one superficial elevated type adenoma with RER-positive phenotype are shown in Figs 1 and 2 (patient 2). Superficial elevated type adenomas exhibited RER-positive phenotype more frequently than protruded type adenomas with statistical significance (p = 0.027). As regards carcinomas, half were RER positive in both early and advanced carcinomas. No loss of heterozygosity (LOH) was found in any microsatellite loci examined.
Figure 1. Macroscopic picture of one superficial elevated type adenoma with genetic instability (patient 2). Figure 2. Gel pattern of RER test at TP53 microsatellite, using DNAs derived from patient 2. 1, Adenoma of ascending colon (9 mm); 2, adenoma of ascending colon (20 mm); 3, adenoma of transverse colon (20 mm); 4, adenoma of transverse colon (15 mm), a macroscopic picture of which is shown in Fig. 1. Shift band is detected in lane 4. We detected no mutation of exon 1-4 of the APC gene in any sample (not shown). Table 3.
Tumor
Type
Configuration
RER (-)
RER (+)
Adenoma
Protruded
I s
5
0
I sp
2
0
I p
6
0
Superficial elevated
II a
4
2
Carcinoma
Early
I p
0
1
II a + II c
1
0
Advanced
Type2
1
1
DISCUSSION
Adenomas and/or carcinomas in two out of four patients with multiple colorectal adenomas exhibited RER-positive phenotype. Although both patients with genetic instability did not meet the Japanese criteria of HNPCC (24), one 64-year-old male (patient 2) had multiple superficial elevated adenomas through the colorectum. Two (40%) out of five superficial elevated adenomas exhibited RER-positive phenotype at two loci examined. Although we did not search germline mutations of known mismatch repair (MMR) genes, the probability of HNPCC was strongly suspected and subtotal colectomy was performed in accordance with genetic counseling of the patient and his family. Although Lynch (25) proposed that prophylactic surgery should be well accepted in patients carrying germline mutation of MMR genes as in FAP patients, it is still controversial whether prophylactic subtotal colectomy is the treatment of choice in HNPCC patients. As previous studies (26) suggested, mutations of known MMR genes could be detected in only a small proportion of HNPCC patients and a mutational search for the MMR genes has not been practical so far. On the other hand, the RER test is readily applicable in clinical settings because it is technically easier and not time-consuming. Hence, for patients with multiple superficial elevated adenomas the RER test would be helpful in determining their treatment. If the results of the RER test are positive, prophylactic surgery should be considered because the possibility that such cases belong to subgroups of HNPCC would be high.
With regard to the relationship between genetic instability and macroscopic configuration, none (0%) of 13 protruded type adenomas and two (33.3%) cases out of six superficial elevated type adenomas exhibited RER-positive phenotype. This difference was statistically significant (p = 0.027). These data suggested that genetic instability is an early event in the development of carcinomas from superficial elevated type adenomas and that genetic instability is associated with the macroscopic configuration of adenomas in patients with multiple colorectal adenomas. Superficial elevated adenoma as a precursor of colorectal carcinomas was first described by Muto et al. (27) and several authors (28,29) have reported a lower incidence of K-ras mutation in superficial elevated adenomas than in polypoid adenomas and proposed that carcinogenesis through superficial elevated type adenomas could be different from the ordinary adenoma-carcinoma sequence. Our data also supported this hypothesis and suggested that carcinogenesis through superficial elevated type adenomas could be initiated by mismatch repair deficiency, which is different from ordinary colorectal carcinogenesis. Further studies are needed to clarify molecular mechanism of multiple colorectal adenomas.
Acknowledgment
This study was supported in part by a grant-in-aid from the Ministry of Health and Welfare of Japan.
References
This article has been cited by other articles:
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 8 Aug 1998
Copyright©Japanese Journal of Clinical Oncology, 1998.
![]()
CiteULike
Connotea
Del.icio.us What's this?
![]()
![]()

![]()
![]()
![]()
L. Ricciardiello, A. Goel, V. Mantovani, T. Fiorini, S. Fossi, D. K. Chang, V. Lunedei, P. Pozzato, R. M. Zagari, L. De Luca, et al.
Frequent Loss of hMLH1 by Promoter Hypermethylation Leads to Microsatellite Instability in Adenomatous Polyps of Patients with a Single First-Degree Member Affected by Colon Cancer
Cancer Res.,
February 15, 2003;
63(4):
787 - 792.
[Abstract]
[Full Text]
[PDF]
![]()
This Article ![]()
![]()
Abstract
![]()
Alert me when this article is cited
![]()
Alert me if a correction is posted
![]()
Services ![]()
![]()
Email this article to a friend
![]()
Similar articles in this journal
![]()
Similar articles in ISI Web of Science
![]()
Similar articles in PubMed
![]()
Alert me to new issues of the journal
![]()
Add to My Personal Archive
![]()
Download to citation manager
![]()
Search for citing articles in:
ISI Web of Science (7)
![]()
Request Permissions
![]()
Google Scholar ![]()
![]()
Articles by Sasaki, S
![]()
Articles by Muto, T
![]()
Search for Related Content
![]()
PubMed ![]()
![]()
PubMed Citation
![]()
Articles by Sasaki, S
![]()
Articles by Muto, T
![]()
Social Bookmarking ![]()
![]()
What's this?