Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrow Request Permissions
Google Scholar
Right arrow Articles by Mizobuchi, S.
Right arrow Articles by Sasaguri, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mizobuchi, S.
Right arrow Articles by Sasaguri, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Japanese Journal of Clinical Oncology 30:423-428 (2000)
© 2000 Foundation for Promotion of Cancer Research

Association Between p53 Immunostaining and Cigarette Smoking in Squamous Cell Carcinoma of the Esophagus

Shunji Mizobuchi1, Mutsuo Furihata2, Hiroshi Sonobe2, Yuji Ohtsuki2, Tadanori Ishikawa1, Hiroshi Murakami1, Atsushi Kurabayashi1, Shohei Ogoshi3 and Shiro Sasaguri1,+,§

1Department of Surgery II, 2Department of Pathology II and 3Vice President, Kochi Medical School, Kochi, Japan


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Background: It is generally accepted that cigarette smoking is closely associated with esophageal squamous cell carcinoma. This study investigated the molecular targets of cigarette smoke in carcinogenesis of the esophagus.

Methods: Seventy-four patients with esophageal squamous cell carcinoma (SCC) were grouped according to daily cigarette consumption: heavy smoking group (group H) (n = 26), moderate smoking group (group M) (n = 39) and non-smoking group (group N) (n = 9). We compared p53 and retinoblastoma (RB) expression among the three groups by immunohistochemistry. In addition, fresh tumor tissues from 30 smokers with esophageal SCC were tested for p53 mutations in exons 5–8 by direct sequencing.

Results: Staining for the p53 product was positive in 65.4% of group H, 38.5% of group M and 44.4% of group N. The frequency of positive staining in the group H was significantly higher than in group M (p = 0.033) and in group M + group N (p = 0.034). The difference with respect to the frequency of overexpression of RB was not significant. The patterns of p53 base-pair mutations in direct sequencing study were of five types, most commonly G:C to T:A transversion (35.3%).

Conclusions: Our study suggests that one of the molecular targets of cigarette smoke is the p53 gene. The pattern of p53 point mutations involved a wide range of base-pair changes.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
It is generally accepted that cigarette smoking is closely associated with esophageal squamous cell carcinoma (SCC) (1,2). However, the molecular targets of cigarette smoke have not been firmly identified. For head and neck SCC, another neoplasm related to smoking, Brennan et al. (3) reported that a history of tobacco consumption is associated with a high frequency of p53 mutations. The p53 and retinoblastoma (RB) tumor suppressor genes, which encode nuclear phosphoproteins that play a regulatory role in normal cell growth, have recently been shown to be crucial in the pathogenesis of human esophageal cancer (4). To clarify the molecular targets of cigarette smoke, we allocated patients with primary esophageal SCC to three groups according to daily cigarette consumption and compared p53 and RB expression by immunohistochemistry among the groups. In addition, p53 mutations were examined in 30 smokers by direct DNA sequencing.


    PATIENTS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A total of 74 patients (63 men and 11 women), who underwent esophagectomy for esophageal SCC at our hospital between March 1982 and April 1996 were evaluated retrospectively. They were grouped according to daily cigarette consumption: a heavy smoking group (group H), with daily consumption of over 21 cigarettes for more than 10 years (n = 26); a moderate smoking group (group M), with daily consumption of between one and 20 cigarettes for more than 10 years (n = 39); and a non-smoking group (group N) (n = 9). The clinicopathological features of the patients and the frequency of overexpression of cancer-related genes, including p53 and RB, were compared among the three groups. From 30 patients in groups M and H who underwent esophagectomy for esophageal SCC between May 1993 and April 1998, tumor residues were snap-frozen and stored at –80°C. DNA was extracted as described previously (5) from the surgical specimens. The location of the tumor within the esophagus and the depth of tumor invasion were determined according to the TNM classification (6). Information on etiological factors, including tobacco and alcohol consumption and a family history of cancer, was obtained for each patient from hospital charts. Alcohol consumption was converted into grams of ethanol based on the content of each type of beverage.

Immunohistochemistry
Sections 5 µm thick from archival formalin-fixed paraffin-embedded tissues were placed on poly-L-lysine-coated slides (Sigma Chemical, St. Louis, MO) for immunohistochemistry study. The expression of p53 and RB proteins were assessed by immunohistochemistry using an anti-p53 monoclonal antibody (DO-7, Dako, Kyoto, Japan; diluted 1:30) and an anti-human RB monoclonal antibody (3H3, MBL, Nagoya, Japan; dilution 1:40). After blocking of endogenous peroxidase activity, the sections were washed in phosphate-buffered saline (PBS; pH 7.4). The heat-induced antigen retrieval technique was used for each immunostaining. The sections were heated in a pressure cooker with 10 mM sodium citrate buffer (pH 6.0) for 12 min at 132°C. Deparaffinized sections were pretreated with normal goat serum for 30 min and incubated with each antibody at 4°C for 24 h. After washing with 0.1 M PBS (pH 7.4), the streptavidin–biotin complex (ABC) procedure was performed using a streptavidin–biotin complex peroxidase kit (DAKO LSAB kit, Dakopatts, Kyoto, Japan). The sections were briefly counterstained with methyl green before mounting. Control sections of known positive cases of esophageal SCC were included in each run and a negative control was carried out by omitting the primary antibody.

Nuclear staining was considered positive if the chromogen was detected in at least 5% of all nuclei within a microscopic field (5,7). The expression of RB protein in a tumor was considered to be negative when positive nuclear staining was observed in immediately adjacent non-neoplastic cells, but not in the tumor cell itself (5).

Direct Sequence Analysis for p53
Our study concentrated on exons 5–8 of the gene, since previous studies had demonstrated that these exons harbor the most inactivating mutations in many diverse types of human tumors. Direct DNA sequencing was performed using a procedure described previously (8). The sequences of the primers used for polymerase chain reaction (PCR) amplifications were as follows: exon 5 (forward) TTCCTCTTCCTGCAGTACTC, (reverse) GCTCCAGCTGCTCACCATCG; exon 6 (forward) CACTGATTGCTCTTAGGTCTG, (reverse) AGTTGCAAA­CCAGACCTCAG; exon 7 (forward) GTGTTGTCTCCTAGGTTGGC, (reverse) CAAGTGGCTCCTGACCTGGAG; exon 8 (forward) CCTATCCTGAGTAGTGGTAATC, (reverse) GCTCTGCTTGCTTACCTCGC.

Differences among the three groups were analyzed using the chi-squared test with Fisher’s exact probability test and by Student’s t-test.

Because of the small size of group N, we compared the degrees of p53 and RB expression by immunohistochemistry among the three groups and between group H and group M + group N.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Clinicopathological Features
The average daily cigarette consumption in groups H and M was 40.7 ± 16.5 and 17.4 ± 4.3, respectively. There was a significant difference between the two groups (p < 0.001). Although the cigarette-year in group H was significantly shorter than in group M (p = 0.009), the tobacco index in group H was significantly higher than in group M (p < 0.001). The average age of patients in group H was significantly lower than those in groups M (p < 0.001) and N (p = 0.006). The number of women in group N was significantly higher than those in the smoking groups (p < 0.001). In the smoking groups, tumors occurred most frequently in the middle thoracic esophagus. Patients in group N, on the other hand, developed tumors most frequently in the lower thoracic region. The difference in tumor location between the smoking groups and group N was significant (group H vs group N, p = 0.007; group M vs group N, p = 0.007). The differences in the histological features, the depth of tumor invasion (pTNM classification) and lymph node metastasis among the three groups were not significant (Table 1). Ten (38.5%) of the patients in group H, 21 (53.8%) in group M and six (66.7%) in group N had third-degree or closer blood relatives with cancers. The difference in the incidence among the three groups was not significant.


View this table:
[in this window]
[in a new window]
 
Table 1. Clinicopathological characteristics of group H (>20 cigarettes/day), group M (1–20 cigarettes/day) and group N (non-smokers)
 
Immunohistochemistry
With respect to the anti-p53 antibody, 65.4% of the 26 tumors in group H, 38.5% of the 39 tumors in group M and 44.4% of the nine tumors in group N exhibited positive nuclear staining (Fig. 1). The frequency of overexpression of p53 in group H was significantly higher than in group M (p = 0.033) and group M + group N (p = 0.034) (Table 2). The differences among the three groups with respect to the overexpression frequency of RB were not significant (Fig. 2 and Table 2).



View larger version (140K):
[in this window]
[in a new window]
 
Figure 1. Typical p53 nuclear protein positive staining patterns with p53 antibody by immunohistochemistry. Almost all cancer cells were stained strongly.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Relationship between expression of oncological gene and cigarette smoking
 



View larger version (305K):
[in this window]
[in a new window]
 
Figure 2. Typical RB nuclear protein staining patterns with RB antibody by immunohistochemistry. The sections were counter-stained with methyl green. (a) Negative staining of cancer cell nuclei; none of the cancer cells (Ca) exhibited RB nuclear staining, but some adjacent normal epithelial cells (N) were positive. (b) Positive staining of cancer cell nuclei; almost all cancer cells were stained strongly.

 
p53 Gene Mutation
The p53 gene was sequenced in tumor specimens from 30 moderate and heavy smokers with esophageal SCC. As shown in Table 3, 20 mutations in the p53 gene were found in 19 of the 30 cases. Seventeen point mutations were detected in 16 cases, including nine in exon 5, one in exon 6, four in exon 7 and three in exon 8. The patterns of p53 base-pair mutations were of five types, involving six cases of G:C->T:A (35.3%), four of G:C->A:T (23.5%), three of A:T->G:C (17.6%), three of A:T->T:A (17.6%) and one of G:C->C:G (5.9%). The 17 point mutations included 13 missense mutations (all of which were positive for p53 protein overexpression), three nonsense mutations and one silent mutation. Of the three cases showing nonsense mutation, one was positive for p53 staining and the others were negative. Of the 11 samples with no alteration of the p53 gene, four were not stained for p53, while the remaining seven samples exhibited positive staining for p53.


View this table:
[in this window]
[in a new window]
 
Table 3. p53 mutations and immunohistochemical detection in patients with SCC of the esophagus who used tobacco
 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Epidemiological studies have revealed that cigarette smoking is positively associated with esophageal SCC. However, very little is known about the effects of cigarette smoking on the molecular events associated with esophageal SCC. Therefore, we evaluated the relationship between cigarette consumption and overexpression of oncological genes associated with esophageal SCC.

The average age of the patients in group H was significantly lower than that in group M. Group H and group M did not differ significantly in male-to-female ratio, the depth of tumor invasion, tumor location, histology of the tumor, lymph node metastasis, the number of drinkers, the average daily alcohol consumption or the number of patients with a family history of cancer. It is therefore likely that the frequency of cigarette smoking is associated with a low age at onset in group H.

The p53 gene, encoding a 53 kDa nuclear phosphoprotein, is a representative tumor suppressor gene that is a crucial regulator of cell growth, differentiation and apoptosis through its actions in cell-cycle checkpoint control (9). Immunohistochemical positivity for p53 protein is in general thought to reflect point mutations of p53 genes in tumor cells, although it is not always synonymous with p53 mutations. In esophageal SCC, the frequency of p53 immunopositivity is reported to be 30–85% (5,10–14). In the present study, the overexpression frequency of p53 was 48.0% (36/75). Lam et al. (15) reviewed 70 cases of esophageal SCC and showed that tobacco use had no significant relationship with positivity or staining intensity for p53, as detected by immunohistochemistry. However, in their study the patients were classified as smokers when they had smoked one or more packs of cigarettes a day for over 2 years. Montesano et al. (16) demonstrated that tobacco smokers with esophageal SCC were much more likely to have p53 mutations than non-smokers with esophageal SCC and the frequency of p53 mutations increased with the dose (number of cigarettes smoked per day). In the present study, smokers who had smoked for more than 10 years were grouped according to their daily cigarette consumption. We found that the frequency of p53 overexpression in group H was significantly higher than those in group M and in group M + group N.

Recent studies have indicated that p53 gene alteration as well as p53 protein accumulation are frequently detected in dysplastic or precancerous lesions adjacent to SCC of the esophagus (11,1719). Thus, such a p53 alteration may occur as an early event in the tumorigenesis of esophageal SCC. In the present study, therefore, a low age at tumor onset in group H may be associated with a high frequency of p53 overex­pression.

In head and neck SCC, a wide range of p53 mutations have been found, most commonly G:C->A:T, G:C->T:A and A:T->G:C (3). In our patients with SCC of the esophagus who used tobacco, the pattern of p53 point mutations was almost the same as that in head and neck SCC. Several reports have discussed the high incidence of the association of separate primary tumors in the head and neck region and the esophagus (2,2022). The head and neck region is adjacent to the esophagus. The mucosae in each are composed of squamous epithelia and are similarly exposed to environmental carcinogens. It is therefore reasonable that the wide range of patterns of p53 point mutations detected in our cases of esophageal SCC is similar to that in head and neck SCC.

Carcinogens may leave unique ‘fingerprints’ in the form of specific mutations that cause the initiation or progression of cancer (23,24). With respect to cigarettes, Puisieux et al. (25) suggested that benzo[a]pyrene in tobacco smoke specifically causes G:C->T:A mutations in the p53 gene in lung cancer. Mutations of the p53 gene in patients with bladder cancer who smoked typically consisted of G:C->C:G and A:T->G:C (26,27). These mutations may result from the aromatic amines and N-[4-(5-nitro-2-furyl)-2-thiaxolyl]formamide, both of which are present at increased levels in urothelial cells of cigarette smokers. The different base-pair changes of p53 point mutations in the present study, therefore, suggest that the smoked cigarette produces various kinds of carcinogens, although further accumulation of cases and studies will be necessary.

Normal RB protein exhibits positive nuclear staining by immunohistochemistry and it has been established that the finding of a negative RB protein expression pattern permits a fairly good estimation of the mutation frequency in the RB gene (28,29). In the present study, there was no significant difference in the frequency of cases showing negative RB protein among the three groups and between group H and group M + group N. Therefore, the RB protein may not be a site of genetic damage caused by cigarette smoking.

In group N, the proportion of non-smoking, non-drinking women was significantly high compared with the smoking groups. Additionally, although tumors in the smoking groups most frequently occurred in the middle thoracic esophagus, those in group N most frequently developed in the lower thoracic esophagus. These findings suggest that other factors may be associated with carcinogenesis in non-smoking and non-drinking patients. It will be important to examine a larger number of cases to evaluate carcinogenesis in non-smoking and non-drinking patients.

In conclusion, the results of this study indicate that one of the molecular targets of cigarette smoke is the p53 gene and that damage to this gene depends on the number of cigarettes smoked per day. Furthermore, the pattern of p53 point mutations in SCC of the esophagus shows a wide spectrum of base-pair changes.


    FOOTNOTES
 
+ For reprints and all correspondence: Shunji Mizobuchi, Department of Surgery II, Kochi Medical School, Kohasu, Okohcho, Nankoku, Kochi 783-8505, Japan. E-mail: mizoshun@kochi-ms.ac.jp Back

§ Abbreviations: SCC, squamous cell carcinoma; RB, retinoblastoma Back


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 PATIENTS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
1 Brown LM, Blot WJ, Schuman SH, Smith WM, Ershow AG, Marks RD, et al. Environmental factors and high risk of esophageal cancer among men in coastal South Carolina. J Natl Cancer Inst 1988;80:1620–5.[Abstract/Free Full Text]

2 Mizobuchi S, Kato H, Tachimori Y, Watanabe H, Yamaguchi H, Itabashi M. Multiple primary carcinoma of the oesophagus. Surg Oncol 1993;2:249–53.[Web of Science][Medline]

3 Brennan JA, Boyle JO, Koch WM, Goodman SN, Hruban RH, Eby YJ, et al. Association between cigarette smoking and mutation of the p53 gene in squamous-cell carcinoma of the head and neck. N Engl J Med 1995;332:712–7.[Abstract/Free Full Text]

4 Huang Y, Meltzer SJ, Yin J, Tong Y, Chang EH, Srivastava S, et al. Altered messenger RNA and unique mutational profiles of p53 and Rb in human esophageal carcinomas. Cancer Res 1993;53:1889–94.[Abstract/Free Full Text]

5 Ishikawa T, Furihata M, Ohtsuki Y, Ono H, Inoue A, Ogoshi S. Aberrant expression of p53 and retinoblastoma gene products in human esophageal squamous cell carcinoma. Int J Oncol 1997;11:1109–14.

6 Hermanek P, Sobin LH. (editors). TNM Classification of Malignant Tumors, 4th ed. Springer: New York 1987;40–2.

7 Furihata M, Ohtsuki Y, Ogoshi S, Takahashi A, Tamiya T, Ogata T. Prognostic significance of human papillomavirus genomes (type-16, -18) and aberrant expression of p53 protein in human esophageal cancer. Int J Cancer 1993;54:226–30.[Web of Science][Medline]

8 Kogan SC, Doherty M, Gitschier J. An improved method for prenatal diagnosis of genetic disease by analysis of amplified DNA sequences. N Engl J Med 1887;317:985–90.[Abstract]

9 Greenblatt MS, Bennett WP, Hollstein M, Harris CC. Mutations in the p53 tumour suppressor gene: clues to cancer aetiology and molecular pathogenesis. Cancer Res 1994;54:4855–78.[Free Full Text]

10 Lam KY, Loke SL, Chen WZ, Cheung KN, Ma L. Expression of p53 in oesophageal squamous cell carcinoma in Hong Kong Chinese. Eur J Surg Oncol 1995;21:242–7.[Medline]

11 Bennett WP, Hollstein MC, He A, Zhu SM, Resau JH, Trump BF, et al. Archival analysis of p53 genetic and protein alterations in Chinese esophageal cancer. Oncogene 1991;6:1779–84.[Web of Science][Medline]

12 Sasano H, Goukon Y, Nishihira T, Nagura H. In situ hybridization and immunohistochemistry of p53 tumor suppressor gene in human esophageal carcinoma. Am J Pathol 1992;141:545–50.[Abstract]

13 Sarbia M, Porschen R, Borchard F, Horstmann O, Willers R, Gabbert HE. p53 protein expression and prognosis in squamous cell carcinoma of the esophagus. Cancer 1994;74:2218–23.[Web of Science][Medline]

14 Shimaya K, Shiozaki H, Inoue M, Tahara H, Monden T, Shimano T, et al. Significance of p53 expression as a prognostic factor in oesophageal squamous cell carcinoma. Virchows Arch 1993;422:271–6.

15 Lam KY, Tsao SW, Zhang D, Law S, He D, Ma L, et al. Prevalence and predictive value of p53 mutation in patients with oesophageal squamous cell carcinomas: a prospective clinico-pathological study and survival analysis of 70 patients. Int J Cancer 1997;74:212–9.[Web of Science][Medline]

16 Montesano R, Hollstein M, Hainaut P. Genetic alterations in esophageal cancer and their relevance to etiology and pathogenesis: a review. Int J Cancer (Pred Oncol) 1996;69:225–35.[Web of Science][Medline]

17 Bennett WP, Holklstein MC, Metcalf RA, Welch JA, He A, Zhu S, et al. p53 mutation and protein accumulation during multistage human esophageal carcinogenesis. Cancer Res 1992;52:6092–7.[Abstract/Free Full Text]

18 Wang LD, Hong JY, Qiu SL, Gao H, Yang CS. Accumulation of p53 protein in human esophageal precancerous lesions: a possible early biomarker for carcinogenesis. Cancer Res 1993;53:1783–7.[Abstract/Free Full Text]

19 Gao H, Wang LD, Zhou Q, Hong JY, Huang TY, Yang CS. p53 tumor suppressor gene mutation in early esophageal precancerous lesions and carcinoma among high-risk populations in Henan, China. Cancer Res 1994;54:4342–6.[Abstract/Free Full Text]

20 Goldstein HM, Zornoza J. Association of squamous cell carcinoma of the head and neck with cancer of the esophagus. Am J Roentgenol 1978;131:791–4.[Web of Science][Medline]

21 Thompson WM, Oddson TA, Kelvin F, Daffner R, Postlethwait RW, Rice RP. Synchronous and metachronous squamous cell carcinomas of the head, neck and esophagus. Gastrointest Radiol 1978;3:123–7.[Web of Science][Medline]

22 Shibuya H, Takagi M, Horiuchi J, Suzuki S, Kamiyama R. Carcinomas of the esophagus with synchronous or metachronous primary carcinoma in the other organs. Acta Radiol Oncol 1982;21:39–43.[Web of Science][Medline]

23 Vogelstein B, Kinzler KW. Carcinogens leave fingerprints. Nature 1992;355:209–10.[Medline]

24 Harris CC, Hollstein M. Clinical implications of the p53 tumor-suppressor gene. N Engl J Med 1993;329:1318–27.[Free Full Text]

25 Puisieux A, Lim S, Groopman J, Ozturk M. Selective targeting of p53 gene mutational hotspots in human cancers by etiologically defined carcinogens. Cancer Res 1991;51:6185–9.[Abstract/Free Full Text]

26 Spruck CH III, Rideout WM III, Olumi AF, Ohneseit PF, Yang AS, Tsai YC, et al. Distinct pattern of p53 mutations in bladder cancer: relationship to tobacco usage. Cancer Res 1993;53:1162–6.[Abstract/Free Full Text]

27 Habuchi T, Takahashi R, Yamada H, Ogawa O, Kakehi Y, Ogura K, et al. Influence of cigarette smoking and schistosomiasis on p53 gene mutation in urothelial cancer. Cancer Res 1993;53:3795–9.[Abstract/Free Full Text]

28 Shew JY, Ling N, Yang X, Fodstad O, Lee WH. Antibodies detecting abnormalities of the retinoblastoma susceptibility gene product (pp110RB) in osteosarcomas and synovial sarcomas. Oncogene Res 1989;1:205–14.

29 Xu HF, Hu SX, Hashimoto T, Takahashi R, Benedict WF. The retinoblastoma susceptibility gene product: a characteristic pattern in normal cells and abnormal expression in malignant cells. Oncogene 1989;4:807–12.[Web of Science][Medline]

Received April 20, 2000; accepted July 24, 2000.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
J. Arredondo, A. I. Chernyavsky, L. M. Marubio, A. L. Beaudet, D. L. Jolkovsky, K. E. Pinkerton, and S. A. Grando
Receptor-Mediated Tobacco Toxicity: Regulation of Gene Expression through {alpha}3{beta}2 Nicotinic Receptor in Oral Epithelial Cells
Am. J. Pathol., February 1, 2005; 166(2): 597 - 613.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
H. H.-X. Xia, S. T. Zhang, S. K. Lam, M. C.-M. Lin, H. F. Kung, and B. C.-Y. Wong
Expression of macrophage migration inhibitory factor in esophageal squamous cell carcinoma and effects of bile acids and NSAIDs
Carcinogenesis, January 1, 2005; 26(1): 11 - 15.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrow Request Permissions
Google Scholar
Right arrow Articles by Mizobuchi, S.
Right arrow Articles by Sasaguri, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mizobuchi, S.
Right arrow Articles by Sasaguri, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?