Japanese Journal of Clinical Oncology 30:504-509 (2000)
© 2000 Foundation for Promotion of Cancer Research
Small Advanced Colorectal Cancers: Clinicopathological Characteristics and Pathogenetic Origin
1Department of Surgery, Division of Surgical Oncology, The University of Tokyo School of Medicine, Tokyo, 2Department of Surgery, Kyorin University School of Medicine, Mitaka and 3Cancer Institute Hospital, Tokyo, Japan
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONCONCLUSIONREFERENCES |
|---|
Background: Recently, increasing numbers of small but deeply invading colorectal cancers have been detected. We conducted the present study to examine the hypothesis that these small advanced cancers are more biologically malignant than larger cancers and to elucidate their pathogenetic origin.
Methods: We analyzed the clinicopathological characteristics of 23 advanced cancers not exceeding 2 cm in diameter (Small-Ca) in comparison with 1117 advanced cancers larger than 2 cm (Large-Ca). We compared the frequency of K-ras mutation and the growth pattern (polypoid growth, PG; non-polypoid growth, NPG) between Small-Ca and 60 submucosal cancers not exceeding 2 cm in diameter (Early-Ca).
Results: Generally, Small-Ca showed less malignant characteristics than Large-Ca. However, Small-Ca with NPG pattern invaded more deeply and metastasized more frequently than those with PG pattern. In Small-Ca, all ulcerated lesions showed NPG pattern, whereas only 14% of protruded lesions did. In Early-Ca, 90% of non-polypoid lesions showed NPG pattern, whereas only 16% of polypoid lesions did. K-ras mutation was less frequent in ulcerated Small-Ca than in polypoid cancers (33 vs 57%). In Early-Ca, non-polypoid cancers showed a lower frequency of K-ras mutation than polypoid cancers (9% vs 46%).
Conclusions: Small-Ca, in general, were less malignant clinicopathologically than Large-Ca; however, Small-Ca with NPG pattern showed a tendency to be more aggressive than those with PG pattern. The similarity of the K-ras mutation rate and growth pattern of ulcerated Small-Ca and non-polypoid Early-Ca suggests that the majority of ulcerated Small-Ca may originate from non-polypoid Early-Ca.
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONCONCLUSIONREFERENCES |
|---|
Most colorectal cancers are believed to arise from pre-existing polypoid adenomas (1). This concept is known as the adenoma–carcinoma sequence. This explains why the majority of early colorectal cancers (i.e. cancers confined to the mucosa or submucosa) are categorized as polypoid type. However, in addition to these polypoid lesions, recent advances in diagnostic procedures such as videoscopy and the increased prevalence of screening for colorectal cancers have allowed the detection of more and more non-polypoid early cancers. Increasing numbers of non-polypoid early colorectal cancers have been reported, especially in Japan (2–4). Non-polypoid early colorectal cancers show a flat appearance, different from polypoid-type early colorectal cancers. It still remains unclear whether these lesions derive from ‘flat adenomas’, supporting the concept of the adenoma–carcinoma sequence or whether they are so-called ‘de novo cancers’, not being preceded by adenomas (3–6).
The most striking feature of non-polypoid early cancers is that they invade the submucosal layer earlier than polypoid cancers even while they are still small in size (4). They may invade further to the muscularis propria or aggressively metastasize while still small. In fact, small but deeply invading advanced colorectal cancers are sometimes encountered. Although many of these small advanced cancers (i.e. cancers invading or infiltrating through the muscularis propria) are believed to originate from non-polypoid early cancers, it has not been demonstrated clearly what percentage of these small advanced cancers have actually developed from non-polypoid early cancers. Therefore, in order to examine whether small advanced cancers are really more aggressive than larger cancers, we compared the clinicopathological characteristics of small and large advanced cancers. Furthermore, to examine whether small advanced cancers have truly developed from non-polypoid early cancers, we examined the pathogenetic correlation between small advanced cancers and early cancers.
Small advanced cancers are a rare population clinically, but might be biologically aggressive and have a unique pathogenetic pathway, so it is interesting and useful in understanding the biology and pathogenesis of colorectal cancer to discuss their characteristics. The purpose of the present study was to elucidate both the characteristics and the origin of small advanced cancers.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONCONCLUSIONREFERENCES |
|---|
To investigate the characteristics of small advanced cancers, we defined them as lesions not exceeding 2 cm in diameter that invade or infiltrate through the muscularis propria of the intestinal wall (Small-Ca). First, we compared the clinicopathological features between Small-Ca and larger advanced cancers exceeding 2 cm in diameter (Large-Ca) and examined whether Small-Ca are truly more aggressive than Large-Ca.
To elucidate the characteristics of tumors in greater detail, we evaluated the growth pattern according to Igekami and co-workers’ classification (5,6) and K-ras mutation in tumor. Submucosal cancers not exceeding 2 cm in diameter (Early-Ca) were also examined, because Early-Ca can be considered as the nearest ‘precursor’ lesions of Small-Ca and comparison of Early-Ca and Small-Ca might be of help in clarifying the origin of Small-Ca.
Patients and Specimens
From January 1963 to December 1995, 1140 advanced colorectal adenocarcinomas (i.e. cancers invading or infiltrating through the muscularis propria) were resected at the Department of Surgical Oncology, Tokyo University Hospital, 23 cases (Small-Ca) of which were 
2 cm in diameter and 1117 (Large-Ca) larger than 2 cm. Sixty cases of Early-Ca were available for pathological examination. All tissue specimens were fixed with formalin and embedded in paraffin. We cut 3 µm sections from each block and stained with hematoxylin and eosin for histological examination and 5–10 µm sections for DNA extraction and ~10 mm2 areas, precisely corresponding to the neoplastic lesions, were cut out of the sections under a microscope. DNA was extracted according to the method of Goelz et al. (7).
Clinicopathological Features
Age, gender, location of lesion, macroscopic appearance, pathological differentiation, depth of invasion [classified according to the TNM classification (8)], lymph node, peritoneal, hepatic and distant (other than hepatic) metastasis, vascular invasion and outcome (5-year survival rate) were compared between Small-Ca and Large-Ca. Macroscopic appearance was divided into protruded type and ulcerated type for advanced cancers and polypoid type and non-polypoid type for submucosal cancers. Non-polypoid early cancers show a flat appearance, different from polypoid type early cancers and include raised (IIa type), raised with central depression (IIa + IIc type), flat (IIb type) and depressed (IIc type) lesions, following the classification of early gastric carcinoma (9).
Growth Pattern
Histological growth patterns of Small-Ca (n = 23) and Early-Ca (n = 60) were examined and classified according to the classification of Igekami and co-workers (5,6), either as polypoid growth (PG) or non-polypoid growth (NPG). Tumors with predominant intramucosal proliferation, especially at the border to normal mucosa, were defined as PG tumors and those without as NPG tumors. Representative PG and NPG tumors are shown Fig. 1(a) and (b), respectively. The lesion in Fig. 1(a) (PG tumor) shows predominant intramucosal proliferation and in its margin, the tumor hangs over the adjacent normal mucosa. On the other hand, the lesion in Fig. 1(b) (NPG tumor) mainly consists of submucosal proliferation of tumor and in its margin, the height of the lesion is equal to or less than that of the adjacent normal mucosa.
|
K-ras Mutation
Since ras mutations in colorectal tumors occur predominantly at codon 12 of K-ras (77–82%) (10,11), we focused on this site of ras genes. DNA was amplified and analyzed by two-step polymerase chain reaction (PCR)–restriction fragment length polymorphism, as described previously (12,13). PCR was performed with a mismatch primer that creates an Mva I recognition site if codon 12 of the template DNA is normal. After Mva I digestion, a second PCR was performed with the mismatch primer to amplify the mutant selectively. The product was cleaved by Mva I and electrophoresed on 8% acrylamide gel. The mutation was detected by the presence of undigested products of the second PCR (106 base pairs). The primers used for PCR were as follows:
A (forward): 5'ACTGAATATAAACTTGTGGTAGTTGGACCT3'
B (reverse): 5'GTCCTGCACCAGTAATATGC3'
C (reverse): 5'CTATTGTTGGATCATATTCG3'
Primers A and B were used for the first PCR and primers A and C for the second. The underlined base of primer A represents a mismatch from the K-ras DNA sequence. Positive and normal controls were run with each analysis (Fig. 2). Among 23 Small-Ca, 21 tumors, in which PCR and K-ras mutation analysis were successful, were examined. In Large-Ca and Early-Ca, samples were selected from tissue archive of each macroscopic type at random and cases successfully analyzed for K-ras mutation constituted nine protruded and 20 ulcerated tumors in Large-Ca and 13 polypoid and 16 non-polypoid tumors in Early-Ca.
|
Statistical Analysis
The chi-squared test was used. For survival analysis, the Kaplan–Meier method and log rank test were used. Values of p <0.05 were considered statistically significant.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONCONCLUSIONREFERENCES |
|---|
Comparison of Small-Ca and Large-Ca
Clinicopathological Features
The clinicopathological features of Small-Ca and Large-Ca are shown in Table 1. Small-Ca consisted of 23 cases, which comprised 2% of all advanced cancers. In comparison with Large-Ca, cases of Small-Ca were older in age. Sigmoid colon cancers were more frequent in Small-Ca than they were in Large-Ca (not significant). Macroscopically, the majority of lesions were ulcerated type in each group. However, Small-Ca showed a significantly higher percentage of protruded type than Large-Ca. Regarding depth of invasion (T classification), a significantly higher percentage of Small-Ca were confined to the muscularis propria (T2), compared with Large-Ca. Less Small-Ca were with lymph node metastasis and the 5-year survival rate of Small-Ca was higher than that of Large-Ca, although the differences were not statistically significant. Other factors (gender, pathological differentiation, hepatic metastasis, peritoneal dissemination and vascular invasion) were not different between the two groups.
|
The clinicopathological features of Small-Ca were examined by dividing them into PG (n = 6) and NPG tumors (n = 15) (Table 2). Two cases of Small-Ca were unclassifiable as either PG or NPG tumors. NPG tumors showed a tendency to invade more deeply. Moreover, all the cases with lymph node metastasis, hepatic metastasis, peritoneal dissemination or distant metastasis showed NPG pattern. Lymphatic invasion was more frequent in NPG tumors than PG tumors (not significant).
|
Comparison of Small-Ca and Early-Ca
Growth Pattern
Table 3 shows the percentages of the lesions with NPG pattern among the lesions of each macroscopic type. In Small-Ca, all ulcerated lesions showed NPG pattern, whereas only 14% of protruded lesions did (p < 0.05). In Early-Ca, non-polypoid lesions showed a significantly higher percentage of NPG pattern than did polypoid lesions (p < 0.05).
|
K-ras Mutation
Table 4 shows the incidence of K-ras mutation among the lesions of each macroscopic type. In Small-Ca, ulcerated cancers showed a lower incidence of K-ras mutation than protruded cancers and in Early-Ca, non-polypoid cancers showed a lower incidence of K-ras mutation than polypoid cancers, although the differences were not statistically significant. In Large-Ca there was no difference in K-ras mutation rate according to the macroscopic type.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONCONCLUSIONREFERENCES |
|---|
Although it is postulated that small advanced cancers are biologically more aggressive (14), the present study revealed that this was not correct. Our results demonstrated that, compared with Large-Ca, Small-Ca metastasize to lymph nodes less frequently and have a better prognosis. Large-Ca invaded more deeply than Small-Ca, but the results were the same even when compared among lesions with each depth of invasion (proper muscle, subserosa, etc.; data not shown). Thus, Small-Ca did not show a more aggressive nature than Large-Ca in general.
In order to clarify the origin of small advanced cancers, we examined the growth pattern of Small-Ca and Early-Ca according to Igekawa and co-workers’ classification (5,6). They classified the growth pattern of colorectal cancers into two types, PG and NPG, and claimed that tumors with different growth patterns have different pathogenetic pathways. PG tumors derive from polypoid adenomas showing the adenoma–carcinoma sequence, while NPG are de novo-type cancers. Therefore, by dividing tumors into PG or NPG type, we examined the origin of tumors. In Small-Ca, NPG pattern was observed in 100% of ulcerated lesions and in only 17% of protruded lesions. In Early-Ca, NPG pattern was seen in 90% of non-polypoid cancers and only 16% of polypoid cancers. If the growth pattern does not change during cancer progression from Early-Ca to Small-Ca, this similarity of growth pattern strongly suggests that ulcerated Small-Ca derive from non-polypoid Early-Ca, whereas protruded Small-Ca derive from polypoid Early-Ca.
We then examined K-ras mutation to analyze further the origin of Small-Ca. Vogelstein et al. demonstrated multiple genetic alterations in colorectal tumors and suggested that ras mutation occurs in the early stage of carcinogenesis (15). However, recently, it has been suggested that there is a different pathogenetic pathway without ras mutations (12,13,16,17). Many studies claim that a low incidence of K-ras mutations is associated with a flat appearance in the early stage of carcinogenesis and, therefore, non-polypoid Early-Ca show a low incidence of K-ras mutation, whereas polypoid Early-Ca show a high incidence (12,13,16,17). In fact, our study showed that the incidence of K-ras mutation in non-polypoid Early-Ca was lower than that in polypoid Early-Ca. Similarly, ulcerated Small-Ca showed a lower incidence of K-ras mutation than protruded Small-Ca, although the differences were not statistically significant. Therefore, the low incidence of K-ras mutation in both ulcerated Small-Ca and non-polypoid Early-Ca may support the idea that ulcerated Small-Ca derive from non-polypoid Early-Ca and not from polypoid Early-Ca.
Considering their original lesions, we examined the clinicopathological characteristics of Small-Ca in more detail. When all Small-Ca were examined as one group, Small-Ca did not show a more aggressive nature than Large-Ca. However, when these lesions were divided into PG and NPG cancers, NPG cancers showed a tendency to be more malignant (depth of invasion, lymph node, hepatic, peritoneal and distant metastasis and lymphatic invasion) compared with PG cancers.
|
CONCLUSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONCONCLUSIONREFERENCES |
|---|
Small-Ca, in general, showed less malignant clinicopathological characteristics than Large-Ca. Regarding the origin of Small-Ca, the majority of Small-Ca were ulcerated lesions, which might derive from non-polypoid Early-Ca. Among Small-Ca, in spite of their size, some lesions showed a tendency to be more aggressive and these malignant lesions showed an NPG pattern. Therefore, these highly malignant Small-Ca might originate from non-polypoid Early-Ca and not from polypoid Early-Ca.
|
FOOTNOTES |
|---|
+ For reprints and all correspondence: Soichiro Ishihara, Department of Surgery, Division of Surgical Oncology, The University of Tokyo School of Medicine, 7–3–1 Hongo, Bunkyo-ku, Tokyo 113-8655, Japan. E-mail: ishihara-1su@h.u-tokyo.ac.jp
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONCONCLUSIONREFERENCES |
|---|
1 Muto T, Bussey HJ, Morson BC. The evolution of cancer of the colon and rectum. Cancer 1975;36:2251–70.[Web of Science][Medline]
2 Wada R, Matsukuma S, Abe H, Kuwabara N, Suda K, Arakawa A, et al. Histopathological studies of superficial-type early colorectal carcinoma. Cancer 1996;77:44–50.[Web of Science][Medline]
3 Kuramoto S, Oohara T. Flat early cancers of the large intestine. Cancer 1989;64:950–5.[Medline]
4 Kudo S, Tamura S, Hirota S, Sano Y, Yamano H, Serizawa M, et al. The problem of de novo colorectal carcinoma. Eur J Cancer 1995;31A:1118–20.
5 Ikegami M. A pathological study on colorectal cancer. From de novo carcinoma to advanced carcinoma. Acta Pathol Jpn 1987;37:21–37.[Medline]
6 Shimoda T, Ikegami M, Fujisaki J, Matsui T, Aizawa S, Ishikawa E. Early colorectal carcinoma with special reference to its development de novo. Cancer 1989;64:1138–46.[Web of Science][Medline]
7 Goelz SE, Hamilton SR, Vogelstein B. Purification of DNA from formaldehyde fixed and paraffin embedded human tissue. Biochem Biophys Res Commun 1985;130:118–26.[Web of Science][Medline]
8 Hermanek P, Sobin LH. TNM Classification of Malignant Tumors. Berlin: Springer 1987;47–9.
9 Watanabe T, Muto T, Sawada T, Miyaki M. Flat adenoma as a precursor of colorectal carcinoma in hereditary nonpolyposis colorectal carcinoma. Cancer 1996;77:627–34.[Web of Science][Medline]
10 Bos JL, Fearon ER, Hamilton SR, Verlaan-de Vries M, van Boom JH, van der Eb AJ, et al. Prevalence of ras gene mutations in human colorectal cancers. Nature 1987;327:293–7.[Medline]
11 Oudejans JJ, Slebos RJ, Zoetmulder FA, Mooi WJ, Rodenhuis S. Differential activation of ras genes by point mutation in human colon cancer with metastases to either lung or liver. Int J Cancer 1991;49:875–9.[Medline]
12 Yamagata S, Muto T, Uchida Y, Masaki T, Higuchi Y, Sawada T, et al. Polypoid growth and K-ras codon 12 mutation in colorectal cancer. Cancer 1995;75:953–7.[Web of Science][Medline]
13 Yamagata S, Muto T, Uchida Y, Masaki T, Sawada T, Tsuno N, et al. Lower incidence of K-ras codon 12 mutation in flat colorectal adenomas than in polypoid adenomas. Jpn J Cancer Res 1994;85:147–51.[Web of Science][Medline]
14 Trecca A, Fujii T, Kato S, Hasebe T, Tajiri H, Yoshida S. Small advanced colorectal adenocarcinomas: report on three cases. Endoscopy 1998;30:493–5.
15 Vogelstein B, Fearon ER, Hamilton SR, Kern SE, Preisinger AC, Leppert M, et al. Genetic alterations during colorectal-tumor development. N Engl J Med 1988;319:525–32.[Abstract]
16 Fujimori T, Satonaka K, Yamamura-Idei Y, Nagasako K, Maeda S. Non-involvement of ras mutations in flat colorectal adenomas and carcinomas. Int J Cancer 1994;57:51–5.[Web of Science][Medline]
17 Hasegawa H, Ueda M, Watanabe M, Teramoto T, Mukai M, Kitajima M. K-ras gene mutations in early colorectal cancer: flat elevated vs polyp-forming cancer. Oncogene 1995;10:1413–6.[Medline]
Received June 1, 2000; accepted September 11, 2000.
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||