Japanese Journal of Clinical Oncology 31:327-332 (2001)
© 2001 Foundation for Promotion of Cancer Research
Prognostic Value of nm23 Expression in Stage IB1 Cervical Carcinoma
1Department of Obstetrics and Gynecology and 3Department of Pathology, China Medical College Hospital, Taichung and 2Institution of Medical Sciences, China Medical College, Taichung, Taiwan
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONPATIENTS AND METHODSRESULTSDISCUSSIONAcknowledgmentREFERENCES |
|---|
Background: The purpose of this retrospective study was to evaluate the patterns of nm23 expression in stage IB1 squamous cell carcinoma of the uterine cervix, to compare nm23 expression with clinicopathological findings and to assess its prognostic value.
Methods: Twenty-seven patients with stage IB1 squamous cell carcinoma of the uterine cervix underwent abdominal radical hysterectomy and pelvic lymph node dissection. Expression of nm23 was studied immunohistochemically, followed by amplification and direct sequencing of exons 4 and 5 of the nm23 gene.
Results: Overexpression of nm23 was detected in 18.5% of the tumors and low expression was seen in 33.3%, while negative expression was found in 48.1% of the tumors. Deep cervical stromal invasion (
1/2) was found to be associated with the increased risk of lymph node metastases (odds ratio = 17.5). A significantly lower percentage of patients survived when nm23 overexpression was observed (p = 0.0063). Univariate analysis revealed that tumor size (2–3.9 cm), lymph node metastasis, tumor invasion into parametria, tumor invasion into blood/lymph vessel, squamous cell carcinoma (2 ng/ml) and nm23 overexpression had a significantly lower recurrence-free survival rate of the patients. None of the above factors was significant according to multivariate analysis. There were no mutations in exons 4 and 5 of the nm23 gene in stage IB1 squamous cell carcinoma of the uterine cervix.
Conclusions: This study suggests that expression of nm23 may be indicative of an unfavorable prognosis in patients with stage IB1 squamous cell carcinoma of the uterine cervix.
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONPATIENTS AND METHODSRESULTSDISCUSSIONAcknowledgmentREFERENCES |
|---|
Based on statistics from 1992, cervical cancer is the most prevalent female cancer in Taiwan, with an incidence rate of 32.1 per 100 000 and a death rate of 7.0 per 100 000 (1). In Taiwan, invasive cervical carcinoma of stage IB and IIA is usually treated with radical hysterectomy and pelvic lymphadenectomy (2). Reports indicate that these procedures result in a 10–40% recurrence rate with a 5-year survival rate ranging from 72.1 to 90.3% (3).
Cervical cancer and precancer are easily diagnosed by direct vision, using vaginal cytology, colposcopy and punch biopsy. However, the extent of the disease, its positive response to treatment and its recurrence are not easily determined (4). Lymphangiography, angiography, magnetic resonance imaging and computed tomography can be performed to identify lymph node metastasis and parametrial invasion, but these techniques are limited (5–7). Because therapy and prognosis differ according to the extent of the disease, it is important to determine the extent of the disease before treatment. Yet there are no available means of doing so other than surgical exploration (4).
The nm23 gene has been suggested to represent a new class of metastasis-associated genes (8). The expression of the nm23 gene was found to be inversely related to the metastatic potential. Its importance to human disease was established by demonstrating an inverse relationship between nm23 transcript expression and lymph node metastasis as well as poor prognosis of human breast cancer (9–12). However, the relationship between nm23 gene expression and prognosis is less clear-cut in other human tumors (13). To our knowledge, the prognostic value of nm23 expression in stage IB1squamous cell carcinoma of the uterine cervix is uncertain.
The purpose of this retrospective study was to evaluate the patterns of nm23 expression in stage IB1 squamous cell carcinoma of the uterine cervix, to compare nm23 expression with clinicopathological findings and to assess its prognostic value.
|
PATIENTS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONPATIENTS AND METHODSRESULTSDISCUSSIONAcknowledgmentREFERENCES |
|---|
Study Population
Between July 1991 and December 1997, 27 patients with stage IB1 squamous cell carcinoma of the uterine cervix underwent abdominal radical hysterectomy and pelvic lymph node dissection at the Department of Obstetrics and Gynecology, China Medical College Hospital, Taichung, Taiwan. The patient group included 18 cases of negative lymph node metastases and nine cases of positive lymph node metastases. Preoperative investigations included detailed histories, pelvic and rectal examination, full blood count, clotting parameters, electrolytes, liver function tests, renal function tests, carcinoma antigen 125 (CA-125), carcinoembryonic antigen (CEA), squamous cell carcinoma antigen (SCC), chest X-ray, computed tomography scan of the abdomen and pelvis, cystoscopic examination and sigmoidoscopic examination. Eleven (41%) of these cases received postoperative pelvic irradiation because of the presence of one or more risk factors, such as lymph node metastases, parametrial involvement or section margin involvement. The total dose given was 70 Gy, including 2 Gy 20 times, plus 2.5 Gy in a booster dose for both the right and left lower quadrants of the abdomen four times, and intracavity radiotheraphy of 10 Gy twice. The follow-up period after treatment ranged from 24 to 71 months (median: 35 months).
Histopathological Evaluation
Routine histological evaluation was performed on hematoxylin and eosin-stained sections. Squamous cell carcinoma was graded as well, moderately and poorly differentiated (14). In addition, the following histopathological risk factors were evaluated: (1) tumor size, (2) lymph–vascular space involvement, (3) parametrial invasion, (4) deep cervical stromal invasion (greater than half) and (5) metastases to pelvic lymph nodes.
Immunohistochemistry
Sections (7 µm) of formalin-fixed, paraffin-embedded tissues mounted on poly-D-lysine-coated slides were deparaffinized in xylene and rehydrated through serial baths of alcohol to water. The slides were placed in 6 M urea and heated in a microwave oven at 700 W for 5 min twice. The hydrated sections were then treated in methanol containing 0.3% hydrogen peroxide for 30 min to eliminate endogenous peroxidase activity and washed in phosphate-buffered saline (PBS). The primary antibody used in this study was a polyclonal antibody to nm23 (DAKO, Glostrup, Denmark). The polyclonal antibody-treated slides were rinsed in PBS solution and incubated with a biotinylated secondary antibody (Signet, USA). The slides were washed in PBS and then incubated with an avidin–biotin–peroxidase complex (Signet) for 30 min. After washing with PBS, a chromogenic reaction was developed by incubating with a freshly prepared solution of 3,3'-diaminobenzidine tetrahydrochloride (0.04%) and hydrogen peroxide (0.03%).
Evaluation of Immunostaining
For all of the immunostaining assays, tumors were scored by assessing the site of staining and the proportion of stained cells and then scored by a semi-quantitative method. After determining the scores, the cases were separated into four categories: – for <10% positive tumor cells; + for 10–30% positive tumor cells; ++ for 30–50% positive tumor cells; and +++ for >50% positive tumor cells (15). Negative expression was defined as the presence of <10% nm23-positive tumor cells, low expression was defined as the presence of 10–30% nm23-positive tumor cells and overexpression was detected when 30% of the cells were nm23 positive.
DNA Extraction from Paraffin-embedded Specimens
The tissue samples were obtained by cutting 10 µm thick sections from archival paraffin-embedded tissue blocks. The average surface area of tissue was 1 cm2. A fresh microtome blade was used on each specimen to reduce the risk of contamination (16). Eight 10 µm thick tissue sections were placed in an oven at 60°C for 45 min and then deparaffinized with sequential washes of xylene and ethanol as described (17). The deparaffinized tissues were finely minced in liquid nitrogen. After adding 0.5 ml of rare DNA extract reagent (Blossom Biotechnologies, USA), the sample was vortex mixed for 60 min. Nucleic acids were extracted twice with phenol–chloroform and then extracted once with 2-propanol. The DNA was precipitated by the addition of 70% ethanol. The DNA precipitate was dissolved in 20 µl of sterile water. DNA concentration was determined by spectrophotometry at an absorbance of 260 nm.
Amplification of Extracted DNA
For polymerase chain reaction (PCR), oligonucleotide primers flanking exon 4 of the nm23 gene (sense 5' AAGCATGAGGGCAGGGAGAT 3'; antisense 5' CAGCCTCGGAAACCCAAATC 3') and exon 5 of the nm23 gene (sense 5' ATGCTGCTGTGGCTGTAGAT 3'; antisense 5' AGGAGGGGAAATGGATGTGA 3') were used to examine the presence of the nm23 gene in the tissue specimens from cervical cancers. PCR was performed in a total volume of 50 µl with 1 µl extracted DNA, 0.5 µM of each primer, 200 µM of each of dATP, dCTP, dGTP and dTTP, 2.5 units of Taq polymerase and PCR buffer (3.0 mM MgCl2, 50 mM KCl, 10 mM Tris, pH 8.3) (Applied Biosystems, Foster City, CA, USA). The sample used to examine the presence of exon 4 of the nm23 gene was amplified for 35 cycles with the following parameters: denaturation at 94°C for 15 s, annealing at 55°C for 20 s and extension at 72°C for 30 s in a GeneAmp PCR System 2400 programmable thermal cycler (Applied Biosystems). An additional 2 min at 94°C was applied for DNA denaturation prior to the first cycle and 7 min at 72°C for DNA elongation after the last cycle.
The sample used to examine the presence of exon 5 of the nm23 gene was amplified for 35 cycles with the following parameters: denaturation at 94°C for 15 s, annealing at 53°C for 20 s and extension at 72°C for 30 s in a GeneAmp PCR System 2400 programmable thermal cycler (Applied Biosystems). An additional 2 min at 94°C was applied for DNA denaturation prior to the first cycle and 7 min at 72°C for DNA elongation after the last cycle. A 5 µl volume of the amplified products was subjected to electrophoresis in a 2% agarose gel and visualized by UV illumination following ethidium bromide staining.
DNA Sequencing
The corresponding PCR products were purified by either Microcon 100 (Millipore) or agarose gel electrophoresis and a Qiaex II Gel Extraction kit (Qiagen, USA). Direct sequencing of the PCR products was performed with a dRhodamine Terminator Cycle Sequencing Kit (Applied Biosystems). The sequences were resolved and analyzed on an ABI Prism 310 DNA Sequencer (Applied Biosystems).
Statistical Analysis
The chi-squared test was used to evaluate the correlation between clinicopathological variables (such as tumor size and nm23 expression) and lymph node metastasis. When the assumption of the chi-squared test was violated (i.e. when >1 cell had an expected count of <1 or >20% of the cells had an expected count of <5), Fisher’s exact test was used. Kaplan–Meier curves were used to plot the recurrence-free survival rate according to nm23 expression in all patients. The log-rank test was then used to compare the recurrence-free survival distributions over time between groups with different nm23 expression status. Univariate and multivariate analysis for recurrence-free survival rates were performed by the Cox proportional hazards regression models. A p value of <0.05 was considered statistically significant.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONPATIENTS AND METHODSRESULTSDISCUSSIONAcknowledgmentREFERENCES |
|---|
nm23 Expression
It was found that nm23 expression was generally localized in the cytoplasm. Reactivity was observed in normal squamous epithelium of the cervix in seven of eight (87.5%) control cases. No reactivity was observed in endocervical cylindrical epithelium. Expression of nm23 was observed in the cytoplasm of tumor cells in 14 of the specimens (51.9%) with stage IB1 squamous cell carcinoma of the uterine cervix (Fig. 1). Overexpression of nm23 was detected in 18.5% of the tumors and low expression was seen in 33.3%, while negative expression was found in 48.1% of the tumors.
|
We assessed the relationship between clinical features, clinicopathological variables and lymph node metastasis (Tables 1 and 2). Of these, only deep cervical stromal invasion (
1/2) was found to be associated with an increased risk of lymph node metastases (odds ratio = 17.5; 95% CI 2.365–129.506).
|
|
Fig. 2 shows the recurrence-free survival curves in relation to nm23 expression. Considering the entire study group, a significantly lower percentage of patients survived when overexpression was observed (log-rank test,
2 = 10.13; p = 0.0063).
|
Univariate analysis of these 16 clinical and clinicopathological factors showed that tumor size (2–3.9 cm), lymph node metastasis, tumor invasion into parametria, tumor invasion into blood/lymph vessel, SCC (
2 ng/ml) and nm23 overexpression had a significantly lower recurrence-free survival rate (Table 3). Tumor size (2–3.9 cm), lymph node metastasis, tumor invasion into parametria, tumor invasion into blood/lymph vessel, SCC (2 ng/ml) and nm23 overexpression were included in the multivariate analysis. None of these analyses attained significant values.
|
No Mutations for Exons 4 and 5 of nm23 Gene
Patients with overexpression of nm23 had lower 2.5-year recurrence-free survival rates than patients in the low expression group. The authors hypothesized that nm23 had undergone mutation resulting in impaired function. In order to test this hypothesis, genomic DNA from paraffin-embedded tissues was extracted. PCR was used to amplify products from exons 4 and 5 of the nm23 gene. The PCR products then underwent agarose gel electrophoresis. The products were sequenced and the results revealed no mutations for exons 4 and 5 of the nm23 gene in stage IB1 squamous cell carcinoma of the uterine cervix.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONPATIENTS AND METHODSRESULTSDISCUSSIONAcknowledgmentREFERENCES |
|---|
In cervical carcinomas, prognosis appears to depend on the presence of important clinicopathological factors, such as lymph node metastases, tumor size, evidence of deep stromal invasion, lymph–vascular space involvement, parametrial invasion, pathological type and DNA index (18–21). However, many factors are still controversial in their prognostic significance, including cell type (19–21) and DNA index (22,23).
We assessed the relationship between clinical features, clinicopathological variables and lymph node metastasis (Tables 1 and 2). Of these, only deep cervical stromal invasion (1/2) was found to be associated with an increased risk of lymph node metastases (odds ratio = 17.5). The present study shows that the prediction of risk factors of pelvic lymph node metastasis in cervical cancer is similar to the results from deep cervical stromal invasion reported previously (24).
Considering the entire study group, a significantly lower percentage of patients survived when nm23 overexpression was observed (log-rank test, 2 = 10.13; p = 0.0063). This result is similar to Kristensen et al.’s report (13) and is in accordance with findings in squamous cell carcinoma of the lung (25) and pancreatic cancer (26). It has been reported that overexpression of nm23 is associated with decreased rates of lymph node metastasis and good prognosis of human breast cancer (9–12). However, our results were not consistent with these findings. The authors speculated that nm23 had undergone mutation which resulted in impaired function. No mutations in exons 4 and 5 of the nm23 gene in stage IB1 squamous cell carcinoma of the uterine cervix were found in this study. We will investigate further the role of exons 1, 2 and 3.
Univariate analysis of these 16 clinical and clinicopathological factors showed that tumor size (2–3.9 cm), lymph node metastasis, tumor invasion into parametria, tumor invasion into blood/lymph vessel, SCC (2 ng/ml) and nm23 overexpression had a significantly lower recurrence-free survival rate. These findings are similar to those in other reports (2,3,13,17–20). Tumor size (2–3.9 cm), lymph node metastasis, tumor invasion into parametria, tumor invasion into blood/lymph vessel, SCC (2 ng/ml) and nm23 overexpression were included in the multivariate analysis. However, because of the small sample size, none of these statistical analyses proved significant. This finding is being investigated in a larger patient series. Nevertheless, these parameters were found to play possible roles increasing the risk of lymph node metastasis.
The significant negative correlation of nm23 expression with recurrence-free survival may have been due to recurrences of the cervical cancer. Overexpression of nm23 was associated with low recurrences in the distal area (2/3) and represented a high risk of recurrence (relative hazard = 0.1063). However, deep cervical stromal invasion (1/2) was associated with lymph node metastasis, which usually recurred in the distal area (3/3) and also represented a low risk of recurrence (relative hazard = 0.0940).
This retrospective study suggests that expression of nm23 may be indicative of an unfavorable prognosis in patients with stage IB1 squamous cell carcinoma of the uterine cervix. Analysis of larger cohorts with cervical cancer is needed to examine the wider applicability of these findings.
|
Acknowledgment |
|---|
|
TOPABSTRACTINTRODUCTIONPATIENTS AND METHODSRESULTSDISCUSSIONAcknowledgmentREFERENCES |
|---|
The authors thank the China Medical College for financially supporting this research under Contract CMC88-TH-04.
|
FOOTNOTES |
|---|
+ For reprints and all correspondence: Weng-Cheng Chang, China Medical College, No. 91 Hsueh-Shih Road, Taichung, Taiwan.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONPATIENTS AND METHODSRESULTSDISCUSSIONAcknowledgmentREFERENCES |
|---|
1 Chang PY. Cancer Registry Annual Report. Department of Health, ROC: Taipei, 1996.
2 Yuan CC, Wang PH, Lai CR, Tsu EJ, Yen MS, Ng HT. Recurrence and survival analyses of 1115 cervical cancer patients treated with radical hysterectomy. Gynecol Obstet Invest 1999;47:127–32.[Web of Science][Medline]
3 Averette HS, Nguyen HN, Donato DM, Penalver MA, Sevin BU, Estape R, et al. Radical hysterectomy for invasive cervical cancer: a 25-year prospective experience with Miami technique. Cancer 1993;71:1422–37.[Web of Science][Medline]
4 Ito H, Takagi Y, Ando Y, Kubo A, Hashimoto S, Tsutsui F, et al. Serum ferritin levels in patients with cervical cancer. Obstet Gynecol 1980;55:358–62.[Web of Science][Medline]
5 Hsu CT, Chang HT. Lymphography in uterine cervical cancer cases. J Obstet Gynecol ROC 1966;5:7–48.
6 Stage AH, Thomson JH. The use of pelvic angiography in assessing carcinoma of the cervix. Obstet Gynecol 1978;52:151–4.[Web of Science][Medline]
7 Ho CM, Chien TY, Jeng CM, Tsang YM, Shih BY, Chang SC. Staging of cervical cancer: comparison between magnetic resonance imaging, computed tomography and pelvic examination under anesthesia. J Formosan Med Assoc 1992;91:982–90.[Medline]
8 Steeg PS, Bevilacqua G, Kopper L, Thorgeirsson UP, Talmadge JE, Liotta LA, et al. Evidence for a noval gene associated with low tumor metastatic potential. J Natl Cancer Inst 1988;80:200–4.
9 Bevilacqua G, Sobel ME, Liotta LA, Steeg PS. Association of low nm23 RNA levels in human primary infiltrating ductal breast carcinomas with lymph node involvement and other histopathological indications of high metastatic potential. Cancer Res 1989;49:5185–90.
10 Hennessy C, Henry JA, May FEB, Westley BR, Angus B, Lennard TWJ. Expression of the antimetastatic gene nm23 in human breast cancer: an association with good prognosis. J Natl Cancer Inst 1991;83:281–5.
11 Barnes R, Masood S, Barker E, Rosengard AM, Coggin DL, Crowell T, et al. Low nm23 protein expression in infiltrating ductal breast carcinomas correlates with reduced patient survival. Am J Pathol 1991;139:245–50.[Abstract]
12 Hirayama R, Sawai S, Takagi Y, Mishima Y, Kimura N, Shimada N, et al. Positive relationship between expression of anti-metastatic factor (nm23 gene product or nucleoside diphosphate kinase) and good prognosis in human breast cancer. J Natl Cancer Inst 1991;83:1249–50.
13 Kristensen GB, Holm R, Abeler VM, Trope CG. Evaluation of the prognostic significance of nm23/NDP kinase protein expression in cervical carcinoma: an immunohistochemical study. Gynecol Oncol 1996;61:378–83.[Web of Science][Medline]
14 Ferenczy A, Winkler B. Carcinoma and metastatic tumors of the cervix. In: Kurman RJ, editor. Blaustein’s Pathology of the Female Genital Tract, 3rd ed. New York: Springer 1987;237–40.
15 Patel DD, Bhatavdekar JM, Chikhlikar PR, Patel YV, Shah NG, Ghosh N, et al. Clinical significance of p53, nm23 and bcl-2 in T3–4N1M0 oesophageal carcinoma: an immunohistochemical approach. J Surg Oncol 1997;65:111–6.[Web of Science][Medline]
16 Alaibac M, Filotico R, Giannella C, Paradiso A, Labriola A, Marzullo F. The effect of fixation type on DNA extracted from paraffin-embedded tissue for PCR studies in dermatopathology. Dermatology 1997;195:105–7.[Web of Science][Medline]
17 Goelz SE, Hamilton SR, Vogelstein B. Purification of DNA from formaldehyde fixed and paraffin embedded human tissue. Biochem Biophys Res Commun 1985;130:118–26.[Web of Science][Medline]
18 Hatch KD, Fu YS. Cervical and vaginal cancer. In: Berek JS, Adashi EY, Hillard PA, editors. Novak’s Textbook of Gynecology, 12th ed. Baltimore: Williams & Wilkins 1996;1111–53.
19 Lai CH, Chang HC, Chang TC, Hsueh S, Tang SG. Prognostic factors and impacts of adjunvant therapy in early-stage cervical carcinoma with pelvic node metastases. Gynecol Oncol 1993;51:390–6.[Web of Science][Medline]
20 Lee YN, Wang KL, Lin MH, Liu CH, Wang KG, Lan CC, et al. Radical hysterectomy with pelvic lymph node dissection for treatment of cervical cancer: a clinical review of 954 cases. Gynecol Oncol 1989;32:135–42.[Web of Science][Medline]
21 Sigurdsson K, Harfnkelsson J, Geirsson G, Gudmundsson J, Salvarsdottir A. Screening as a prognostic factor in cervical cancer: analysis of survival and prognostic factor based on Icelandic population data, 1964–1988. Gynecol Oncol 1991;43:64–70.[Web of Science][Medline]
22 Connor JP, Miller DS, Bauer KD, Murad TM, Rademaker AW, Lurain JR. Flow cytometric evaluation of early invasive cervical cancer. Obstet Gynecol 1993;81:367–71.[Web of Science][Medline]
23 Nguyen HN, Sevin BU, Averette HE, Ramos R, Ganjei P, Perras J. Evidence of tumor heterogeneity in cervical cancers and lymph node metastases as determined by flow cytometry. Cancer 1993;71:2543–50.[Web of Science][Medline]
24 Changchien CC, Eng HL, Chen WJ. Prediction of risk factors of pelvic lymph node metastasis in stage I and II cervical cancer patients. J Obstet Gynecol ROC 1991;30:178–82.
25 Engel M, Theisinger B, Seib T, Seitz G, Huwer H, Zang KD, et al. High levels of nm23-H1 and nm23-H2 messenger RNA in human squamous-cell lung carcinoma are associated with poor differentiation and advanced tumor stages. Int J Cancer 1993;55:375–9.[Web of Science][Medline]
26 Nakamori S, Ishikawa O, Ohhigashi H, Kameyama M, Furukawa H, Sasaki Y, et al. Expression of nucleoside diphosphate kinase/nm23 gene product in human pancreatic cancer: an association with lymph node metastasis and tumor invasion. Clin Exp Metastasis 1993;11:151–8.[Web of Science][Medline]
Received January 15, 2001; accepted March 21, 2001.
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  M Branca, C Giorgi, M Ciotti, D Santini, L Di Bonito, S Costa, A Benedetto, D Bonifacio, P Di Bonito, P Paba, et al. Down-regulated nucleoside diphosphate kinase nm23-H1 expression is unrelated to high-risk human papillomavirus but associated with progression of cervical intraepithelial neoplasia and unfavourable prognosis in cervical cancer J. Clin. Pathol., October 1, 2006; 59(10): 1044 - 1051. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||