Japanese Journal of Clinical Oncology 32:196-201 (2002)
© 2002 Foundation for Promotion of Cancer Research
Increased Frequency of p53 Mutation in Sporadic Colorectal Cancer from Cigarette Smokers
1 Hereditary Tumor Research Project, 4 Department of Surgery and 3 Department of Pathology, Tokyo Metropolitan Komagome Hospital, Tokyo and 2 Institute of Molecular Oncology, Showa University, Tokyo, Japan
| ABSTRACT |
|---|
|
|
|---|
Background: Cigarette smoking has been shown to increase the risk of colorectal cancer. However, the relation between smoking and genetic alterations has not been clarified in this type of cancer.
Methods: Mutations of p53, APC, ß-catenin and K-ras-2 genes were analyzed in colorectal carcinomas from 28 smokers and 33 non-smokers. Frequencies and types of mutations were compared between smokers and non-smokers.
Results: The frequency of carcinomas with p53 mutation was higher in smokers (20/28, 71%) than in non-smokers (15/33, 45%) (P = 0.037). The common type of mutation was single-base substitution including G:C to A:T transition in both groups (68% in smokers and 67% in non-smokers). With respect to G:C to A:T transitions, mutation at CpG sites was less frequent in smokers (9/15, 60%) than in non-smokers (10/10, 100%), whereas mutation at non-CpG sites was more frequent in smokers (6/16, 40%) than in non-smokers (0/10, 0%) (P = 0.028). The frequency of APC mutation was not significantly different between smokers (14/28, 50%) and non-smokers (15/33, 45%). No ß-catenin mutation was detected in carcinomas from smokers. K-ras-2 mutation occurred in smokers at a similar frequency (9/28, 32%) to that in non-smokers (13/33, 39%). Concerning pathological aspects, Dukes A carcinomas were less frequent in smokers (11%) than in non-smokers (33%), whereas Dukes D carcinomas were more frequent in smokers (25%) than in non-smokers (15%).
Conclusion: The present results suggest that an increased frequency of p53 gene mutation, including G:C to A:T transitions at non-CpG sites, is associated with an increased risk of colorectal carcinogenesis in cigarette smokers.
| INTRODUCTION |
|---|
|
|
|---|
Recent large cohort and case control studies have demonstrated that cigarette smoking is a risk factor for colorectal cancer incidence (1,2) and many previous studies have also suggested an association between cigarette smoking and colon cancer or adenoma (310). Smoking has been found to form many carcinogenic compounds which reach various tissues directly or indirectly. Carcinogens are known to cause genetic changes in multiple tumor suppressor genes and oncogenes resulting in cancer formation. Of these genes, p53 gene is commonly mutated in human cancer including colon, stomach, lung, head and neck, bladder cancers and various other types of cancer. Accordingly, p53 gene is considered to be suitable as a marker in the examination of the effect of tobacco carcinogens on molecular pathogenesis of various cancers. In the case of lung cancer, a strong association with smoking has been shown (11,12) and one of the genetic targets for the risk of lung cancer has been revealed to be the p53 gene (1316). Increased frequency and altered spectrum of p53 mutation have been observed in lung cancer from not only smokers, but also non-smokers exposed to environmental tobacco smoke (1315). An effect of smoking on the p53 gene has also been observed in bladder cancer (17). In head and neck cancer, heavy smokers have been shown to have an elevated p53 expression (18). However, in the case of colorectal cancer, genetic targets of smoking are still unknown, although DNA adducts with compounds formed by tobacco smoking have been detected in the colonic mucosa (19). With respect to colorectal carcinogenesis, we have previously demonstrated that it proceeds through multiple steps, including genetic change of APC, p53, Smad4, ß-catenin and K-ras-2 genes (2024). To clarify which genes are targets of cigarette smoking, we analyzed p53, APC, ß-catenin and K-ras-2 genes in colorectal cancer from cigarette smokers and non-smokers. The results indicated an increased frequency of p53 gene mutation in smokers.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Tumor Samples
Sixty-one sporadic primary colorectal carcinoma samples were obtained from 61 Japanese patients at Tokyo Metropolitan Komagome Hospital after informed consent. All samples were invasive adenocarcinomas. Patients were divided into two groups: non-smokers (33 cases) and smokers (28 cases). In the latter group, amounts of cigarette smoking (number of cigarettes per day x years) ranged from 400 to 4080 (mean 961). Surgically removed tumors were histopathologically diagnosed and appropriate areas of tumor tissues were frozen at 80°C until they were used for mutation analysis.
Mutation Analysis
DNA was isolated from fresh frozen tumor tissue samples and corresponding normal tissues by the proteinase Kphenolchloroform method. Exons 4 (codon 33) through 10 (codon 367) of the p53 gene, exons 14 (codon 582) through 15I (codon 1640) of the APC gene, exon 3 of the ß-catenin gene and exon 1 (including codons 12 and 13) of the K-ras-2 gene were analyzed by the PCR-SSCP method. DNA fragments in abnormal bands were amplified by asymmetric PCR and then sequenced by the dideoxy termination method as described previously (21). PCR primers for exons 48 of p53 gene were the same as those previously reported (22) and primers for exon 9 were sense TGATGAGAATTCGCCTCTTTCCTAGCACTG and antisense TGATGAGAATTCCCAAGACTTAGTACCTGA and for exon 10 they were sense TGATGAGAATTCCTCTGTTGCTGCAGATCC and antisense TGATGAGAATTCGCTGAGGTCACTCACCT. Primers for the APC gene were the same as those reported previously (25). Primers for exon 3 of the ß-catenin gene were the same as those used previously (24). Primers for the K-ras-2 gene were sense ATGACTGAATATAAACTTGT and antisense TCCACAAAATGATTCTGAAT.
Statistical Method
Frequencies of mutations were compared between smokers and non-smokers using Fishers exact test. A P-value of <0.05 was considered significant.
| RESULTS |
|---|
|
|
|---|
p53 Gene Mutation
DNA samples of 28 colorectal carcinomas from cigarette smokers and those of 33 colorectal carcinomas from non-smokers were analyzed for exons 410 of the p53 gene by PCR-SSCP and direct sequencing methods. All p53 mutations detected are listed in Table 1. p53 mutations were detected in 20 of 28 carcinomas (71%) from smokers and in 15 of 33 carcinomas (45%) from non-smokers (Table 2). This difference was statistically significant (P = 0.037). Two carcinomas from smokers (MY223 and MY250) exhibited two mutations, the latter case having two mutations in one allele. Accordingly, total mutations detected in smokers were 22 in 28 carcinomas. Eight of 22 mutations (36%) from smokers and nine of 15 mutations (60%) from non-smokers existed at the previously observed hot spot codons in colorectal carcinomas (codons 175, 245, 248, 273 and 282). The spectrum of p53 mutations was compared between smokers and non-smokers (Table 3). The common type of p53 mutation was single-base substitution in both smokers (19/22, 86%) and non-smokers (13/15, 87%). The main mutation direction was G:C to A:T transitions in both groups: this was found in 15 of 22 mutations (68%) in smokers and in 10 of 15 (67%) in non-smokers. With respect to G:C to A:T transitions, the frequency of occurrence at CpG sites was less in smokers (9/15, 60%) than in non-smokers (10/10, 100%). In contrast, the frequency of G:C to A:T transitions at non-CpG sites was higher in smokers (6/15, 40%) than in non-smokers (0/10, 0%) (P = 0.028).
|
|
|
APC Gene Mutation
APC mutation was analyzed for the region (exons 1415I) where >90% of total APC mutations were detected in the case of sporadic colorectal tumors (21,26). The frequency of carcinomas with APC gene mutations was 50% (14/28) in smokers and 45% (15/33) in non-smokers (Table 2). More than 85% of mutations detected (12 of 14 in smokers and 13 of 15 in non-smokers) existed between codons 1300 (exon 15G) and 1580 (exon 15I) (Table 1). The frequencies of deletions were 57% (8/14) and 53% (8/15), insertions 14% (2/14) and 20% (3/15) and single-base substitutions 29% (4/14) and 27% (4/15) in smokers and non-smokers, respectively. All mutations formed stop codons resulting in truncated APC proteins, except for one mutation resulting in deletion of exon 14. Occurrence of APC mutation was independent of the occurrence of p53 mutation.
ß-Catenin Gene Mutation
ß-Catenin mutation from ACC (Thr) to GCC (Ala) at codon 41 was detected in one (MY90) of 33 carcinomas from non-smokers; it was not detected in any of 28 carcinomas from smokers.
K-ras-2 Gene Mutation
K-ras-2 mutation was detected in nine of 28 carcinomas (32%) from smokers and in 13 of 33 carcinomas (39%) from non-smokers (Tables 1 and 2). Both codons 12 and 13 were mutated in these two groups. The direction of mutation was predominantly G to A (glycine to aspartic acid) in both smokers (8/9, 89%) and non-smokers (12/13, 92%). Occurrence of K-ras-2 mutation was independent of the occurrences of p53 and APC mutations.
Pathological Aspects
The frequencies of differentiation types and Dukes stages of colorectal carcinomas were compared between smokers and non-smokers, as shown in Table 4. Well differentiated carcinomas were the most frequent in both groups and the distribution of carcinomas by differentiation type was not obviously different between the two groups. With respect to Dukes stages, Dukes A tumors were less frequent in smokers (3/28, 11%) than in non-smokers (11/33, 33%), whereas Dukes D tumors occurred more frequently in smokers (7/28, 25%) than in non-smokers (5/33, 15%) (Table 4). Moreover, the frequency of G:C to A:T transitions at non-CpG sites in Dukes D tumors with p53 mutations was higher in smokers (3/4, 75%) than in non-smokers (0/3, 0%).
|
| DISCUSSION |
|---|
|
|
|---|
Recent studies have indicated an association between cigarette smoking and an increased risk of colorectal cancer (18,10) and several reports have suggested that smoking is also related to the risk of colorectal adenomas (5,6,9). These observations suggest that smoking causes DNA lesions in the colon that lead to cancer. In the case of lung, an association of smoking with a high risk of cancer has been shown and one target of smoking has been revealed to be the p53 gene (1316). A similar relationship between smoking and p53 mutation has also been observed in the cases of bladder cancer (17) and head and neck cancers (18). In colorectal cancer, however, genetic alterations related to smoking have not yet been clarified.
The present comparative examination of mutations of p53, APC, ß-catenin and K-ras-2 genes in primary colorectal carcinomas from smokers and non-smokers demonstrated that the frequency of p53 mutation was higher in smokers (71%) than in non-smokers (45%). Although the spectrum of mutations was not significantly different between smokers and non-smokers and the main mutation direction was G:C to A:T transition in both groups, the frequency of mutations at non-CpG sites was significantly higher in smokers than in non-smokers. Previous estimation of mutation at the CpG site within G:C to A:T transition was 64% (22) or 76% (27) in colorectal carcinomas, but these studies did not appear to separate carcinomas clearly into smoker and non-smoker categories. The present results indicated that 100% of G:C to A:T transition occurred at the CpG site (and none at the non-CpG site) in non-smokers, which is consistent with the assumption that either 5-methylcytosine in the CpG site is spontaneously deaminated, to result in a thymine (28), or that mutagens unrelated to smoking tend to cause mutation at the CpG site (29,30). In contrast, a significantly high frequency of G:C to A:T transition at the non-CpG site occurring only in smokers suggests the participation of some tobacco-specific mutagens.
Cigarette smoke contains many mutagenic compounds, such as nitrosamines, aromatic amines and polynuclear aromatic hydrocarbons (31,32). The tobacco-specific nitrosamine 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) has been described to be metabolized to methanediazohydroxide, which methylates DNA forming at least 13 different adducts including 7-methylguanine and O6-methylguanine. These DNA adducts lead to G to A transitions (31,33). This compound may cause G:C to A:T transitions at non-CpG sites of p53 gene in colorectal carcinomas in smokers. In spite of the high frequency of G:C to A:T transition, G:C to T:A transversion was low in colorectal carcinomas from non-smokers and it was not increased by smoking. In contrast, in lung cancers G:C to T:A transversion of p53 gene was increased by smoking and this type of mutation was predominant in smokers (16,27). Benzo[a]pyrene has been reported to form adducts at lung cancer mutational hot spots in p53 gene (34), which is assumed to be a cause of G:C to T:A transversion in lung cancers in smokers. Such different effects of smoking on the mutation direction of p53 gene in different organs suggests that different carcinogens in smoke are related to carcinogenesis in different organs.
Increased amounts of DNA-adducts have been detected not only in lung but also other tissues, including gastric mucosa and colonic mucosa, from smokers (19,3437). It has been suggested that the stomach is exposed to tobacco carcinogens through saliva or bronchial secretions (37), and therefore it is possible that the colon is also exposed to such carcinogens in a similar manner.
DNA adducts formed by smoking are assumed to cause mutations in other genes besides p53. Previous observations of an increased risk of colorectal adenoma in smokers (5,6,9) suggested that smoking causes genetic lesions involved in adenoma formation, such as mutation at the APC, ß-catenin or K-ras-2 gene. In the present study, the frequency of carcinomas with APC mutation was not significantly different between smokers and non-smokers. ß-Catenin gene is not assumed to be the target of smoking, since mutation of this gene was very rare in sporadic colorectal carcinomas and no mutation was detected in carcinomas from smokers. The frequency and direction of K-ras-2 mutation in colorectal carcinomas were not different between smokers and non-smokers, similar to the case of APC mutation. These results seem to be inconsistent with the previous observations of increased risk of adenomas. However, smoking has also been associated with a risk of larger adenomas (5,6) and large adenomas often include carcinomatous components that are assumed to be produced by p53 mutation. If this is the case, the present results of an increased frequency of p53 mutation in smokers may be related to the increased risk of larger adenomas. Alternatively, some de novo-type minute carcinomas, which are formed by p53 mutation in the early stage of carcinogenesis, may be included in adenomatous samples from smokers. Although our present data suggest the association of p53 mutation of colorectal cancer with smoking, one previous report on immunohistochemical analysis for p53 overexpression suggested that colorectal tumors developing through a p53-positive dependent pathway were not associated with smoking exposure (38). This discrepancy may be due to the difference between analytical methods, sequence analysis and immunohistochemical staining. For the determination of p53 gene mutation, the sequence analysis appears to produce more definitive results than immunohistochemical analysis, since immunohistochemical staining of p53 protein is not always equivalent to a mutational change.
There has been evidence that colonic cancers of smokers were at more advanced stages than those of non-smokers (39). It was observed that Dukes stage A tumors occurred more frequently among non-smokers and stage D tumors occurred more frequently among smokers. The present results show similar tendencies in their data with respect to the Dukes stage of carcinomas. In addition to this, G:C to A:T transition mutations at non-CpG sites were detected in Dukes D tumors from smokers, but not in Dukes D tumors from non-smokers. Our previous examinations indicated that p53 mutations contribute to the conversion of colorectal adenoma into early carcinoma (21). Moreover, the frequency of p53 mutations was higher in invasive carcinomas than in intramucosal carcinomas (21), which suggests that p53 gene mutations also contribute to the progression of colorectal carcinomas. Accordingly, the higher frequency of carcinomas at a more advanced stage in smokers may reflect a higher frequency of p53 gene mutations in smokers, although the contribution of other unknown factors to the tumor stage in smokers cannot be excluded.
Recently, passive smoking was also assumed to influence carcinogenesis. However, in the present study, the degree of passive smoking in non-smokers could not be examined.
The present results suggest that an increased frequency of p53 mutation, including G:C to A:T transitions at non-CpG sites, is associated with an increased risk of colorectal carcinogenesis in cigarette smokers.
| Acknowledgements |
|---|
This work was supported in part by the Smoking Research Foundation and the Project High-Technology Research Center of the Ministry of Education, Science, Sport and Culture of Japan.
| FOOTNOTES |
|---|
+ For reprints and all correspondence: Michiko Miyaki, Hereditary Tumor Research Project, Tokyo Metropolitan Komagome Hospital, 31822 Honkomagome, Bunkyo-ku, Tokyo 113-8677, Japan. E-mail: mmiyaki@opal.famille.ne.jp
| REFERENCES |
|---|
|
|
|---|
1 Stürmer T, Glynn RJ, Lee I-M, Christen WG, Hennekens CH. Lifetime cigarette smoking and colorectal cancer incidence in the physicians health study I. J Natl Cancer Inst 2000;92:117881.
2 Chao A, Thun MJ, Jacob EJ, Henley SJ, Rodriguez C, Calle EE. Cigarette smoking and colorectal cancer mortality in the cancer prevention study II. J Natl Cancer Inst 2000;92:188896.
3 Kune GA, Kune S, Vietta L, Watson LF. Smoking and colorectal cancer risk: data from the Melbourne colorectal cancer study and brief review of literature. Int J Cancer 1992;50:36972.[Web of Science][Medline]
4 Giovannucci E, Martinez ME. Tobacco, colorectal cancer and adenomas: a review of evidence. J Natl Cancer Inst 1996;88:171730.
5 Giovannucci E, Rimm EB, Stampfer MJ, Colditz GA, Ascherio A, Kearney J, et al. A prospective study of cigarette smoking and risk of colorectal cancer in U.S. men. J Natl Cancer Inst 1994;86:18391.
6 Giovannucci E, Colditz GA, Stampfer MJ, Hunter D, Rosner BA, Willett WC, et al. A prospective study of cigarette smoking and risk of colorectal adenoma and colorectal cancer in U.S. women. J Natl Cancer Inst 1994;86:1929.
7 Heineman EF, Hoar Zahm S, McLaughlin JK, Vaught JB. Increased risk of colorectal cancer among smokers: results of a 26-year follow-up of US veterans and a review. Int J Cancer 1995;59:72838.
8 Newcomb PA, Storer BE, Marcus PM. Cigarette smoking in relation to risk of large bowel cancer in women. Cancer Res 1995;55:49069.
9 Martinez ME, McPherson RS, Annegers JF, Levin B. Cigarette smoking and alcohol consumption as risk factors for colorectal adenomatous polyps. J Natl Cancer Inst 1995;87:2749.
10 Slattery ML, Potter JD, Friedman GD, Ma K-N, Edwards S. Tobacco use and colon cancer. Int J Cancer 1997;70:25964.[Web of Science][Medline]
11 Doll R, Peto R, Wheatley K, Gray R, Sutherland I. Mortality in relation to smoking: 40 years observations on male British doctors. Br Med J 1994;309:90111.
12 Carbone D. Smoking and cancer. Am J Med 1992;93:1A-13S17S.
13 Suzuki H, Takahashi T, Kuroishi T, Suyama M, Ariyoshi Y, Takahashi T, et al. p53 mutations in non-small lung cancer in Japan: association between mutations and smoking. Cancer Res 1992;52:7346.
14 Husgafvel-Pursiainen K, Boffetta P, Kannio A, Nyberg F, Pershagen G, Mukeria A, et al. p53 mutation and exposure to environmental tobacco smoke in a multicenter study on lung cancer. Cancer Res 2000;60:290611.
15 Ahrendt SA, Chow JT, Yang SC, Wu L, Zhang M-J, Jen J, et al. Alcohol consumption and cigarette smoking increase the frequency of p53 mutations in non-small cell lung cancer. Cancer Res 2000;60:31559.
16 Takagi Y, Osada H, Kuroishi T, Mitsudori T, Kondo M, Niimi T, et al. p53 mutations in non-small-cell lung cancer occurring in individuals without a past history of active smoking. Br J Cancer 1998;77:156872.[Web of Science][Medline]
17 Spruck CH III, Rideout WM III, Olumi AF, Ohneseit PF, Yang AS, Tsai YC, et al. Distinct pattern of p53 mutations in bladder cancer: relationship to tobacco usage. Cancer Res 1993;53:11626.
18 Field JK, Spandidos DA, Malliri A, Gosney JR, Yiagnisis M, Stell PM. Elevated P53 expression correlates with a history of heavy smoking in squamous cell carcinoma of head and neck. Br J Cancer 1991;64:5737.[Web of Science][Medline]
19 Alexandrov K, Rojas M, Kadluber FF, Lang NP, Bartsch H. Evidence of anti-benzo[a]pyrene diolepoxideDNA adduct formation in human colon mucosa. Carcinogenesis 1996;17:20813.
20 Miyaki M, Seki M, Okamoto M, Yamanaka A, Maeda M, Tanaka K, et al. Genetic change and histopathological types in colorectal tumors from patients with familial adenomatous polyposis. Cancer Res 1990;50:716673.
21 Miyaki M, Konishi M, Kikuchi-Yanoshita R, Enomoto M, Igari T, Tanaka K, et al. Characteristics of somatic mutation of the adenomatous polyposis coli gene in colorectal tumors. Cancer Res 1994;54:301120.
22 Kikuchi-Yanoshita R, Konishi M, Ito S, Seki M, Tanaka K, Maeda Y, et al. Genetic changes of both p53 alleles associated with the conversion from colorectal adenoma to early carcinoma in familial adenomatous polyposis and non-familial adenomatous polyposis patients. Cancer Res 1992;52:396571.
23 Miyaki M, Iijima T, Konishi M, Sakai K, Ishii A, Yasuno M, et al. Higher frequency of Smad4 gene mutation in human colorectal cancer with distant metastasis. Oncogene 1999;18:3098103.[Web of Science][Medline]
24 Miyaki M, Iijima T, Kimura J, Yasuno M, Mori T, Hayashi Y, et al. Frequent mutation of ß-catenin and APC genes in primary colorectal tumors from patients with hereditary nonpolyposis colorectal cancer. Cancer Res 1999;59:45069.
25 Groden J, Thliveris A, Samowitz W, Carlson M, Gelbert L, Albertsen H, et al. Identification of deletion mutations and three new genes at the familial polyposis locus. Cell 1991;66:60113.[Web of Science][Medline]
26 Miyoshi Y, Nagase H, Ando H, Horii A, Ichii S, Nakatsuru S, et al. Somatic mutations of APC gene in colorectal tumors: mutation cluster region in the APC gene. Hum Mol Genet 1992;1:22933.
27 Greenblatt MS, Bennett WP, Hollstein M, Harris CC. Mutations in the p53 tumor suppressor gene: clues to cancer etiology and molecular pathogenesis. Cancer Res 1994;54:485578.
28 Rideout WM III, Coetzee GA, Olumi AF, Jones PA. 5-Methylcytosine as an endogeneous mutagen in the human LDL receptor and p53 gene. Science 1990;249:128890.
29 Chen JX, Zheng Y, West M, Tang M-S. Carcinogens preferentially bind at methylated CpG in the p53 mutational hot spots. Cancer Res 1998;58:20705.
30 Knekt P, Järvinen R, Dich J, Hakulinen T. Risk of colorectal and other gastro-intestinal cancers after exposure to nitrate, nitrite and N-nitroso compounds: a follow-up study. Int J Cancer 1999;80:8526.[Web of Science][Medline]
31 Hecht SS. Tobacco and cancer: approaches using carcinogen biomarkers and chemoprevention. Ann N Y Acad Sci 1997;833:91111.[Web of Science][Medline]
32 IARC Monographs on the Evolution of Carcinogenic Risk of Chemicals to Humans: Vol 38: Tobacco Smoking. Lyon: IARC 1998.
33 Ronai ZA, Gradia S, Peterson LA, Hecht SS. G to A transitions and G to T transversions in codon 12 of the Ki-ras oncogene isolated from mouse lung tumors induced by 4-(methylnitrosamine)-1-(3-pyridyl)-1-butanone (NNK) and related DNA methylating and pyridyloxobutylating agents. Carcinogenesis 1993;14:241922.
34 Denissenko MF, Pao A, Tang M-S, Pfeifer GP. Preferential formation of benzo[a]pyrene adducts at lung cancer mutational hot spots in p53. Science 1996;274:4302.
35 Phillips DH, Hewer A, Martin CN, Garner RC, King MM. Correlation of DNA adduct levels in human lung with cigarette smoking. Nature 1998;336:7902.
36 Cuzick J, Routledge MN, Jenkins D, Garner RC. DNA adducts in different tissues of smokers and non-smokers. Int J Cancer 1990;45:6738.[Web of Science][Medline]
37 Dyke GW, Craven JL, Hall R, Garner RC. Smoking-related DNA adducts in human gastric cancers. Int J Cancer 1992;52:84750.[Web of Science][Medline]
38 Freedman AN, Michalek AM, Marshall JR, Mettlin CJ, Petrelli NJ, Zang Z-F, et al. The relationship between smoking exposure and p53 overexpression in colorectal cancer. Br J Cancer 1996;73:9028.
39 Daniel HW. More advanced colonic cancer among smokers. Cancer 1986;58:7847.[Web of Science][Medline]
Received January 22, 2002; accepted April 1, 2002
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
C. M. Rudin, E. Avila-Tang, C. C. Harris, J. G. Herman, F. R. Hirsch, W. Pao, A. G. Schwartz, K. H. Vahakangas, and J. M. Samet Lung Cancer in Never Smokers: Molecular Profiles and Therapeutic Implications Clin. Cancer Res., September 15, 2009; 15(18): 5646 - 5661. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
