Japanese Journal of Clinical Oncology Advance Access originally published online on May 13, 2005
Japanese Journal of Clinical Oncology 2005 35(5):280-282; doi:10.1093/jjco/hyi080
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
© 2005 Foundation for Promotion of Cancer Research
Cancer and Genetics Report |
A Novel Germline Mutation, 1793delG, of the MEN1 Gene Underlying Multiple Endocrine Neoplasia Type 1
1 Department of Internal Medicine, 2 Department of Pathology and 3 Department of Pediatrics, Faculty of Medicine, Chulalongkorn University, Bangkok, Thailand
For reprints and all correspondence: Thiti Snabboon, Department of Internal Medicine, Faculty of Medicine, Chulalongkorn University, Rama IV Road, Patumwan, Bangkok 10330, Thailand. E-mail: fmedtsb{at}md.chula.ac.th
Received March 27, 2005; accepted April 4, 2005
 |
Abstract |
|---|
 TOP Abstract CASE REPORT AND GENETIC...METHODS FOR MUTATION DETECTIONReferences |
|---|
Pulmonary carcinoids are rare neuroendocrine tumors which comprise 1–2% of all lung tumors. They usually occur sporadically; however, their association with multiple endocrine neoplasia type 1 (MEN1) syndrome has been documented. We report a case of a Thai woman with a pulmonary carcinoid tumor and a null cell pituitary tumor. Her family history was unremarkable for any MEN-related lesions. Genetic testing revealed a novel deletion mutation at exon 10 (1793delG) of the MEN1 gene, resulting in a stop codon 26 amino acids downstream. This mutation is predicted to cause a loss of the second nuclear localization signal of the menin protein.
Key Words: multiple endocrine neoplasia type 1 • pulmonary carcinoid • pituitary macroadenoma
|
CASE REPORT AND GENETIC ANALYSIS |
|---|
|
TOPAbstractCASE REPORT AND GENETIC...METHODS FOR MUTATION DETECTIONReferences |
|---|
Carcinoids are neuroendocrine tumors which originate from enterochromaffin cells (1). They are traditionally classified according to their anatomic site of origin: foregut, midgut or hindgut. Carcinoids can occur either sporadically or as part of familial syndromes. Multiple endocrine neoplasia type 1 (MEN1) syndrome is characterized by the occurrence of neoplasms affecting the parathyroid glands, the pancreatic islet cells and the anterior pituitary gland (2). About 10% of MEN1 cases have been reported in association with carcinoids, especially the foregut type3 (thymic, gastric or pulmonary). Pulmonary carcinoids are rare neoplasms which represent 1–2% of primary lung tumors. They are classified along a spectrum of pulmonary neuroendocrine tumors with clinical behavior and histological differentiation, ranging from the low grade typical carcinoids to the intermediate grade atypical carcinoids to the high grade large cell neuroendocrine carcinomas and small cell carcinomas (4). Unlike thymic carcinoids in MEN1, pulmonary carcinoids occur less frequently in a patient with MEN1 syndrome (<5%) and mainly in females (5).
The proband, a 68-year-old Thai female, was admitted with an asymptomatic lung mass, 7 x 5.9 x 5.1 cm in dimension. Right lower lung lobectomy was performed and its histological findings were compatible with a typical carcinoid tumor. One year later, severe headache developed. A pituitary macroadenoma, 3 x 2 x 3 cm in size, with apoplexy was found on a magnetic resonance imaging study. Hormonal assessment for pituitary function was normal for free T4, thyroid-stimulating hormone (TSH), serum cortisol, adrenocortictrophic hormone (ACTH), insulin-like growth factor-I (IGF-I) and prolactin. Her sex hormone levels were compatible with a menopausal state. Serum calcium and parathyroid hormone levels were in the normal range. Trans-sphenoidal tumor removal was performed and null cell type was confirmed by immunohistochemical study. She was clinically diagnosed with MEN1 syndrome. No other family members developed any MEN1-related lesions (Fig. 1).
|
The MEN1 gene (Table 1), a tumor suppressor gene, encompasses 9.2 kb of genomic DNA and consists of 10 exons encoding a 610 amino acid nuclear protein termed menin (6). Menin is a 67 kDa protein and interacts with a diverse group of transcription factors and co-regulators, including JunD, NF-
B, PEM, Smad3 and mSin3A-histone deacetylase, suggesting its role in the regulation of gene transcription, DNA replication and cell cycle control (7–11). The menin sequence has two nuclear localization signals (NLS1 and NLS2) in the C-terminus corresponding to amino acid residues 479–497 and 588–608, respectively (12). Mutation analysis of the MEN1 gene in our patient revealed a novel heterozygous deletion of guanine (G) at nucleotide 1793 of exon 10 (Fig. 2). This mutation is expected to result in an amino acid change from methionine (Met) to isoleucine (Ile) at codon 561 of the menin protein, producing a stop codon 26 amino acids downstream. The predicted truncated protein lacks the NLS2 locus, which may cause protein instability or loss of function by displacing menin out of the nucleus (13).
|
|
Both of the patient's parents died from unknown causes, and two apparently healthy brothers of the patient declined the genetic testing. In conclusion, our study shows a novel MEN1 gene mutation at exon 10 in a Thai kindred which extends our knowledge concerning the variety of tumor involvement in MEN1 syndrome.
|
METHODS FOR MUTATION DETECTION |
|---|
|
TOPAbstractCASE REPORT AND GENETIC...METHODS FOR MUTATION DETECTIONReferences |
|---|
PCR/direct sequencing of exon 10 and the flanking introns was performed with the following conditions and parameters: PCR primer, forward, 5'GAGTTCCAGCCACTGGCCGG3'; PCR primer, reverse, 5'GGTTTGATACAGACTGTACTCGG3'; size of the PCR product = 673 bp. The thermal cycle profile comprised initial denaturation: 94°C, 5 min, 35 cycles of 94°C, 60 s/65°C, 60 s/72°C, 60 s and final extension at 72°C for 10 min. The sequencing primer was the same as the PCR primers.
|
Acknowledgments |
|---|
This work was funded by the Endocrine and Metabolism Division, Department of Internal Medicine, Chulalongkorn University.
|
References |
|---|
|
TOPAbstractCASE REPORT AND GENETIC...METHODS FOR MUTATION DETECTIONReferences |
|---|
1 Caplin ME, Buscombe JR, Hilson AJ, Jones AL, Watkinson AF, Burroughs AK, et al. Carcinoid tumor. Lancet 1998;352:799–805.[CrossRef][Web of Science][Medline]
2 Brandi ML, Gagel RF, Angeli A, Bilezikian JP, Beck-Peccoz P, Bordi C, et al. Guidelines for diagnosis and therapy of MEN type 1 and type 2. J Clin Endocrinol Metab 2001;86:5658–71.
3 Lehy T, Mignon M, Cadiot G, Elouaer-Blanc L, Ruszniewski P, Lewin MJ, et al. Gastric endocrine cell behaviour in Zollinger–Ellison patients upon long-term potent antisecretory treatment. Gastroenterology 1989;96:1029–40.[Web of Science][Medline]
4 Oliveira AM, Tazelaar HD, Wentzlaff KA, Kosugi NS, Hai N, Benson A, et al. Familial pulmonary carcinoid tumors. Cancer 2001;91:2104–9.[CrossRef][Medline]
5 Hage R, de la Riviere AB, Seldenrijk CA, van den Bosch JM. Update in pulmonary carcinoid tumors: a review article. Ann Surg Oncol 2003;10:697–704.
6 Wautot V, Vercherat C, Lespinasse J, Chambe B, Lenoir GM, Zhang CX, et al. Germline mutation profile of MEN1 in multiple endocrine neoplasia type 1: search for correlation between phenotype and the functional domains of the MEN1 protein. Hum Mutat 2002;20:35–47.[CrossRef][Web of Science][Medline]
7 Agarwal SK, Guru SC, Heppner C, Erdos MR, Collins RM, Park SY, et al. Menin interacts with the AP1 transcription factor JunD and represses JunD-activated transcription. Cell 1999;96:143–52.[CrossRef][Web of Science][Medline]
8 Heppner C, Bilimoria KY, Agarwal SK, Kester M, Whitty LJ, Guru SC, et al. The tumor suppressor protein menin interacts with NF-kappaB proteins and inhibits NF-kappaB-mediated transactivation. Oncogene 2001;20:4917–25.[CrossRef][Web of Science][Medline]
9 Kaji H, Canaff L, Lebrun JJ, Goltzman D, Hendy GN. Inactivation of menin, a Smad3-interacting protein, blocks transforming growth factor type beta signaling. Proc Natl Acad Sci USA 2001;98:3837–42.
10 Kim H, Lee JE, Cho EJ, Liu JO, Youn HD. Menin, a tumor suppressor, represses JunD-mediated transcriptional activity by association with an mSin3A-histone deacetylase complex. Cancer Res 2003;63:6135–9.
11 Lemmens IH, Forsberg L, Pannett AA, Meyen E, Piehl F, Turner JJ, et al. Menin interacts directly with the homeobox-containing protein Pem. Biochem Biophys Res Commun 2001;286:426–31.[CrossRef][Web of Science][Medline]
12 Guru SC, Goldsmith PK, Burns AL, Marx SJ, Spiegel AM, Collins FS, et al. Menin, the product of the MEN1 gene, is a nuclear protein. Proc Natl Acad Sci USA 1998;95:1630–4.
13 La P, Silva AC, Hou Z, Wang H, Schnepp RW, Yan N, et al. Direct binding of DNA by tumor suppressor menin. J Biol Chem 2004;279:49045–54.
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||