Japanese Journal of Clinical Oncology Advance Access published online on August 3, 2007
Japanese Journal of Clinical Oncology, doi:10.1093/jjco/hym066
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
© 2007 Foundation for Promotion of Cancer Research
Prognostic Significance of Insulin-like Growth Factor Binding Protein (IGFBP)-4 and IGFBP-5 Expression in Breast Cancer
1 Oncology and Immunology, Nagoya City University Graduate School of Medical Sciences, Nagoya, Japan
2 Department of Molecular Medical Technology, Tohoku University, Sendai
3 Breast and Endocrine Surgery, Kumamoto University, Kumamoto, Japan
For reprints and all correspondence: Hiroko Yamashita, Oncology and Immunology, Nagoya City University Graduate School of Medical Sciences, Kawasumi 1, Mizuho-ku, Nagoya 467-8601, Japan. E-mail: hirokoy{at}med.nagoya-cu.ac.jp
Received December 10, 2006; accepted March 17, 2007
| Abstract |
|---|
|
|
|---|
Background: Expression of estrogen-regulated genes has been considered as potential predictive markers for endocrine therapy. We focused on two insulin-like growth factor binding proteins (IGFBPs): IGFBP-4, which is an early-responsive estrogen-induced gene, and IGFBP-5, which is an estrogen-repressed gene. Investigation of IGFBP-4 and IGFBP-5 expression would provide important information for predicting prognosis and endocrine responsiveness.
Methods: The levels of IGFBP-4 and IGFBP-5 mRNA expression in 162 human breast cancer tissues were analyzed using quantitative real-time reverse transcriptase-PCR. The association between IGFBP-4 and IGFBP-5 expression and clinicopathological factors was then analyzed.
Results: The levels of IGFBP-4 and IGFBP-5 mRNA expression were positively correlated with estrogen receptor (ER) and progesterone receptor (PgR) status and were negatively correlated with HER2 overexpression. Patients with a high level of IGFBP-4 mRNA expression had better disease-free and overall survival than those with a low expression. Multivariate analysis showed that IGFBP-4 mRNA expression is an independent prognostic factor for disease-free survival. When analyzed in 116 patients with ER-positive breast cancer, patients whose tumor expressed higher levels of IGFBP-4 mRNA or lower levels of IGFBP-5 mRNA had better disease-free survival.
Conclusion: IGFBP-4 mRNA expression was an independent prognostic factor in breast cancer, and patients with ER-positive breast cancer whose tumor expressed higher levels of IGFBP-4 and lower levels of IGFBP-5 had a better prognosis than those without such findings.
Key Words: breast cancer IGFBP-4 IGFBP-5 prognosis
| INTRODUCTION |
|---|
|
|
|---|
Endocrine therapy has become the most important treatment option for women with estrogen receptor (ER)-positive breast cancer. Nevertheless, many breast cancer patients with tumors expressing high levels of ER are unresponsive to endocrine therapy and all patients with advanced disease eventually develop resistance to the therapy (1). Expression of estrogen-regulated genes has been considered to provide predictive markers for endocrine therapy, because their expression may indicate the presence of a functional estrogen-signaling pathway. Using microarray technology, we have identified more than 100 estrogen-regulated genes in MCF-7 human breast cancer cells (2). Of these estrogen-regulated genes, in the present study we focused on two insulin-like growth factor binding proteins (IGFBPs): IGFBP-4, which is an early-responsive estrogen-induced gene, and IGFBP-5, which is an estrogen-repressed gene.
IGFBPs are considered to bind to insulin-like growth factor (IGF)-I and IGF-II in the extracelluar space, regulating access of IGFs to IGF receptors (3), which is one of the most critical steps for proliferation of breast cancer cells. There are six IGFBPs, IGFBP-1 to IGFBP-6, which share 40–60% amino acid identity. IGFBPs bind IGF-I and IGF-II with high affinity, and are essential to transport IGFs, to prolong half-lives, and to regulate the availability of free IGFs for interaction with IGF receptors, thereby modulating the effects of IGFs on growth and differentiation. In addition, recent evidence indicates that some IGFBPs may themselves have direct receptor-mediated effects, independent of IGFs (4). IGFBP-3 is the most abundant IGFBP in human serum and has been shown to be a growth inhibitory, apoptosis-inducing molecule, capable of acting via IGF-dependent and IGF-independent mechanisms (5). The clinical data presented to date provide ambiguous evidence as to whether the IGFBPs, and in particular IGFBP-3, predict a good or poor prognosis in breast cancer (6). Recent studies indicated that high concentrations of IGF-I and IGFBP-3 in the circulation were associated with an increased risk of premenopausal breast cancer (7). IGFBP-4 appears to be a potent inhibitor of IGF function in several human cell lines (8–10). IGFBP-5 plays a critical role in mammary gland development, and, in particular, the removal of mammary epithelial cells by apoptosis that takes place during the involutionary stage of the lactating gland (11). However, little is known about the role of IGFBP-4 and IGFBP-5 in breast cancer.
In the present study, we examined mRNA and protein expression of IGFBP-4 and IGFBP-5 in 162 human breast cancer tissues and analyzed their significance for prognosis.
| PATIENTS AND METHODS |
|---|
|
|
|---|
Patients and Tumor Samples
Primary invasive breast carcinoma specimens were obtained by surgical excision from 162 female patients at Nagoya City University Hospital between 1992 and 2000. Informed consent was obtained from all patients before surgery. The study protocol was approved by the institutional review board and conformed with the guidelines of the 1975 Declaration of Helsinki. The median age of the patients was 57.9 years (range, 28–88 years). The patients' tumors were classified with the International Union Against Cancer (UICC) staging system as follows: 44 cases were classified as stage I, 98 cases as stage II, 17 cases as stage III and 3 cases as stage IV. Patients were graded histopathologically according to the modified Bloom and Richardson method proposed by Elston and Ellis (12). As post-operative adjuvant treatment, tamoxifen was given to patients with ER- and/or progesterone receptor (PgR)-positive tumors. Depending on tumor stage, the following chemotherapy regimens were given: oral 5-fluorouracil, CMF, or FEC. Since 1995, post-operative treatment has been done with reference to the recommendation of St Gullen (13). After surgery, 26 patients (16.0%) received no additional therapy. Of the remaining 136 patients, 82 (50.6%) received systemic therapy consisting of endocrine therapy alone, 10 (6.2%) received chemotherapy alone and 44 (27.2%) received combined endocrine therapy and chemotherapy. Patients were observed for disease recurrence and death at least once every 6 months for 5 years after surgery and yearly thereafter. The median follow-up period was 67 months (range, 2–128 months). Samples were snap-frozen in liquid nitrogen and stored at –80°C until RNA extraction.
Isolation of Total RNA and Reverse Transcription
Total RNA from homogeneous breast cancer tissue, which was microscopically confirmed, was isolated from approximately 500 mg of frozen specimen. Total RNA was also isolated from one flask of HepG2 cells and T47D cells for use as a positive control and to generate standard curves. mRNA was isolated using the TRIZOL reagent (Life Technologies, Inc., Tokyo, Japan) according to the manufacturer's instructions. Reverse transcription reactions were done as previously described (14).
Primers and Probes
We conducted BLAST searches (Genbank) to confirm the specificity of the nucleotide sequences chosen for the primers and probes and to confirm the absence of DNA polymorphism. To avoid detection of contaminating genomic DNA, the primers for IGFBP-4 were located at exon 1 and exon 2, and the primers for IGFBP-5 were located at exon 3 and exon 4. The specific oligonucleotide primers were synthesized according to published information as follows: IGFBP-4, 5' sense TCGAGGCCATCCAGGAAA (602–619) and 3' antisense CCCCATTGACCTTCATCTT (766–748) (165 bp); IGFBP-5, 5' sense CTGTGTACCTGCCCAAT (1411–1427) and 3' antisense CACTGAAAGTCCCCGTCAA (1561–1543) (151 bp). The donor probe for IGFBP-4, 5'-AGCGCCCATGACCGCAG-3' has a fluorescein label at its 3' end and the acceptor probe for IGFBP-4 5'-TGCCTGCAGAAGCACTTC GC-3' has LC Red 640 at its 5' end. For IGFBP-5, the donor probe 5'-CCGCAAACGTGGCATCTGCT-3' and the acceptor probe 5'-GTGCGTGGA CAAGTACGGGATGA-3' were used.
To ensure the fidelity of mRNA extraction and reverse transcription, all samples were subjected to PCR amplification with oligonucleotide primers and probes specific for the constitutively expressed gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and normalized. GAPDH primers were as follows: 5' sense AAATCAAGTGGGGCGATGCTG and 3' antisense GCAGAGATGATGACCCTTTTG. The sequences of the GAPDH probes were as follows: the donor probe, 5'-AGAAGGCTGGGGCTCATTTGCAGGG-3' and the acceptor probe, 5'-GTCCACTGGCGTCTTCACCACCATG-3'. All primers and probes were purchased from the Japanese Gene Institute (Saitama, Japan).
Real-time Reverse Transcription-PCR
Real-time reverse transcription-PCR was done using a LightCycler (Roche Molecular Biochemicals, Mannheim, Germany) as previously reported (15). The PCR reaction for IGFBP-4 and IGFBP-5 was carried out in a final volume of 20 µl containing 2.4 µl of 25 mmol/l MgCl2; 0.5 µl of 20 pmol/µl sense primer and antisense primer; 0.4 µl of 10 pmol/µl donor and acceptor probe; 2 µl of PCR master mix; 1.5 µl of cDNA and made up to 20 µl with water. After an initial denaturation step at 95°C for 60 s, temperature cycling was initiated. Each cycle consisted of denaturation at 95°C for 0 s, hybridization at 57°C for 5 s, and elongation at 72°C for 6 s. The fluorescence signal was acquired at the end of the hybridization step. A total of 55 cycles were performed. Cycling conditions for GAPDH were as follows: initial denaturation at 95°C for 60 s, followed by 50 cycles at 95°C for 0 s, 60°C for 5 s and 72°C for 8 s.
Standard Curves and Presentation of Results
For each PCR run, a standard curve was constructed with serial dilutions of cDNA obtained each from HepG2 cells for IGFBP-4 and T47D cells for IGFBP-5. The level of expression of IGFBP-4 and IGFBP-5 mRNA were given as relative copy numbers normalized against GAPDH mRNA and shown as mean ± SD. Relative IGFBP-4 and IGFBP-5 mRNA expression was calculated by the formula: (IGFBP-4/GAPDH) x 1000 and (IGFBP-5/GAPDH) x 100, respectively.
A non-template negative control was included in each experiment. All of the non-template negative controls, the standard cDNA dilutions from HepG2 cells or T47D cells, and the tumor samples were assayed in duplicate. All of the patient samples with a coefficient of variation for gene mRNA copy number data >10% were retested using the method of Bieche et al. (16).
Immunohistochemical Staining of ER and PgR
Immunohistochemical staining of ER and PgR was done using monoclonal mouse antihuman ER
antibody (1D5, DAKO) at 1:100 dilution for ER and monoclonal mouse antihuman PgR antibody (636, DAKO) at 1:100 dilution for PgR as primary antibodies as previously described (17). The expression of ER and PgR was estimated in accordance with the procedure of Allred and colleagues (18). In brief, a proportion score represented the estimated proportion of tumor cells staining positive, as follows: 0 (none); 1 (<1/100); 2 (1/100 to 1/10); 3 (1/10 to 1/3); 4 (1/3 to 2/3); and 5 (>2/3). Any brown nuclear staining in invasive breast epithelium counted towards the proportion score. An intensity score represented the average intensity of the positive cells, as follows: 0 (none); 1 (weak); 2 (intermediate); and 3 (strong). The proportion and intensity scores were then added to obtain a total score, which could range from 0 to 8. Tumors with a score of 3 or greater were considered to be positive for ER or PgR expression.
Statistical Analysis
Unpaired t test was used for the statistical analysis of the association between IGFBP-4 and IGFBP-5 mRNA expression and clinicopathological factors. Disease-free and overall survival curves were generated by the Kaplan–Meier method and verified with the log-rank test. Cox's proportional hazards model was used for univariate and multivariate analyses of prognostic values. Differences were considered significant when a P < 0.05 was obtained.
| RESULTS |
|---|
|
|
|---|
Patient Demographics and Tumor Characteristics
Clinical characteristics are summarized in Table 1. The amount of IGFBP-4 mRNA in the tissue samples from 162 patients ranged from 17 to 2561 relative copy numbers (mean, 310.4), whereas the amount of IGFBP-5 mRNA ranged from 3 to 4060 relative copy numbers (mean, 165.6).
|
Correlation between IGFBP-4 and IGFBP-5 mRNA Expression and Clinicopathological Factors
The level of IGFBP-4 mRNA expression was significantly correlated with histological grade (P = 0.0032). Positive associations were observed between IGFBP-4 mRNA expression and ER (P = 0.0031) and PgR (P = 0.0045) expression. An inverse correlation was found between IGFBP-4 mRNA expression and HER2 overexpression (P = 0.0007). No association was found between IGFBP-5 mRNA expression and histological grade, ER, PgR and HER2 expression (Table 2).
|
There was no association between IGFBP-4 and IGFBP-5 mRNA expression and age, menopausal status, tumor size, or lymph node status. Interestingly, IGFBP-4 mRNA expression was strongly correlated with IGFBP-5 mRNA expression (Fig. 1).
|
Patients whose Tumor Expressed Higher Levels of IGFBP-4 mRNA had Better Disease-free and Overall Survival
To identify a clinically meaningful cutoff point for levels of IGFBP-4 and IGFBP-5 mRNA expression that could be used in disease prognosis analysis, various levels of IGFBP-4 and IGFBP-5 mRNA expression were tested using the Kaplan–Meier method and verified by the log-rank test. When analyzing disease-free and overall survival, the cutoff points for the levels of IGFBP-4 and IGFBP-5 mRNA were set at 205 and 38, respectively. Patients with a high level of IGFBP-4 mRNA expression (470.2 ± 366.2; n = 86) had better disease-free survival than those with a low expression (102.9 ± 54.0; n = 72) (P = 0.0002, Fig. 2a). Similarly, patients with a high level of IGFBP-4 mRNA expression had better overall survival than those with a low level of expression (P = 0.022, Fig. 2b). However, IGFBP-5 mRNA expression status did not affect disease-free or overall survival (Fig. 2c and d).
|
IGFBP-4 mRNA Expression is an Independent Prognostic Factor of Disease-free Survival in Breast Cancer
Univariate analysis demonstrated that IGFBP-4 mRNA expression (P = 0.0044), as well as tumor size (P = 0.016), lymph node status (P < 0.0001), ER (P = 0.0016), PgR (P = 0.031), HER2 (P = 0.031), and the type of adjuvant therapy (P = 0.028) was strongly able to predict disease-free survival (Table 3). In multivariate analysis, patients with tumors with high IGFBP-4 mRNA expression (P = 0.049), negative lymph node status (P = 0.012), and the type of adjuvant therapy (P = 0.031) had significantly increased disease-free survival (Table 3). For overall survival, univariate analysis (Table 4) showed significant associations between overall survival and IGFBP-4 mRNA expression (P = 0.027), lymph node status (P = 0.0001), histological grade (P = 0.010), ER (P = 0.0002), PgR (P = 0.0027) and HER2 (P = 0.023). There was no significant relation between overall survival and IGFBP-4 mRNA expression in multivariate analysis (Table 4). We concluded from these analyses that IGFBP-4 mRNA expression is an independent prognostic factor of disease-free survival in breast cancer.
|
|
Patients with ER-positive Breast Cancer whose Tumor Expressed Higher Levels of IGFBP-4 mRNA or Lower Levels of IGFBP-5 mRNA had Better Disease-free Survival
We then analyzed disease-free and overall survival in 119 patients with ER-positive breast cancer. Kaplan–Meier analysis of disease-free survival showed that a high level of IGFBP-4 mRNA expression (449.1 ± 272.9; n = 72) was significantly associated with a reduced risk of recurrence than a low level of IGFBP-4 mRNA expression (118.3 ± 52.7; n = 43) (P = 0.018, Fig. 3a); however, there was no correlation between IGFBP-4 mRNA expression and overall survival in these patients (Fig. 3b). Furthermore, only one patient with a tumor that expressed a low level of IGFBP-5 mRNA (16.9 ± 9.8; n = 28) relapsed (P = 0.046, Fig. 3c) and all patients were alive during the follow-up periods (Fig. 3d), whereas 19 patients relapsed who had tumors that expressed a high level of IGFBP-5 mRNA (239.9 ± 526.9; n = 89). Univariate analysis (Table 5) demonstrated that IGFBP-4 mRNA expression (P = 0.022) as well as lymph node status (P = 0.0001) was strongly able to predict risk of recurrence in ER-positive breast cancer. In multivariate analysis (Table 5), patients with tumors with high IGFBP-4 mRNA expression had a significantly increased disease-free survival (P = 0.029), indicating that IGFBP-4 mRNA expression is an independent prognostic factor of disease-free survival in ER-positive breast cancer. There was no significant relation between overall survival and IGFBP-4 and IGFBP-5 mRNA expression in ER-positive breast cancer (Table 6).
|
|
|
| DISCUSSION |
|---|
|
|
|---|
In the present study, we examined mRNA expression of IGFBP-4 and IGFBP-5 in 162 human breast cancer tissues, and demonstrated that IGFBP-4 mRNA expression was an independent prognostic factor in breast cancer, and that patients with ER-positive breast cancer whose tumor expressed higher levels of IGFBP-4 mRNA and lower levels of IGFBP-5 mRNA had a better prognosis that those without such findings.
Although the roles of IGFBP-4 and IGFBP-5 in breast cancer are not well established, it is well known that the pattern of IGFBP expression and secretion relates to the ER status of breast cancer cells (19). It was also reported that IGFBP-4 and IGFBP-5 mRNA concentrations were greater in ER-positive cancer tissues than in ER-negative tumors (19,20), and IGFBP-4 and IGFBP-5 protein expression was correlated positively with ER and PgR (21). Our results also showed that IGFBP-4 mRNA expression was positively associated with ER and PgR expression. On the contrary, it was reported that IGFBP-3 mRNA and protein levels were found to be inversely correlated with ER and PgR levels (22,23).
Although the role of IGFBP-4 in the mammary gland and breast cancer has not been fully elucidated, IGFBP-4 has been reported by several laboratories as one of the early-responsive estrogen-induced genes through studies using microarray technology (2,24,25). It was also reported that IGFBP-4 was up-regulated by estradiol on which ICI182780 acted as an antagonist, whereas tamoxifen and raloxifen acted as partial antagonists (26). We previously reported that expression of histone deacetylase (HDAC) 6, which is a late responsive estrogen-induced gene, is correlated with a better prognosis in breast cancer and that expression of higher levels of HDAC6 tended to be predictive for response to endocrine therapy (14). Our present study showed that IGFBP-4 mRNA expression was an independent prognostic factor in breast cancer. Because the number of patients available for evaluating responsiveness to endocrine therapy in this study was limited, further study is needed to analyze whether IGFBP-4 is a predictive factor for endocrine therapy. Furthermore, a recent study showed that IGFBP-4 is one of the key genes to correlate with tamoxifen resistance by gene expression array and immunohistochemistry tissue micro arrays (27). Because 96 of the 119 patients with ER-positive breast cancer received tamoxifen as an adjuvant therapy in our present study, IGFBP-4 expression levels might have affected the tamoxifen response.
However, IGFBP-5 is an estrogen-repressed gene and our results indicated that only one patient with a tumor that expressed a low level of IGFBP-5 mRNA relapsed and all such patients were alive during the follow-up periods in ER-positive breast cancer. Patients with hormone receptor-positive tumors were given tamoxifen as adjuvant therapy and received endocrine therapy as initial treatment after relapse. Therefore, IGFBP-5 expression might be predictive of response to endocrine therapy. Furthermore, studies using a gene expression profile demonstrated that IGFBP-5 was a gene signature of a poor prognosis (28), and that IGFBP-5 protein expression was elevated in samples of lymph node metastasis (29). Although there was no difference between IGFBP-5 expression and lymph node status or survival in any of the patients in our study, IGFBP-5 expression might be a poor prognostic factor in breast cancer.
We cannot readily explain why IGFBP-4 and IGFBP-5 mRNA expressions were shown to be strongly and positively correlated in our study, although higher levels of IGFBP-4 and lower levels of IGFBP-5 had a better prognosis. Our preliminary immunohistochemical study for IGFBP-4 and IGFBP-5 protein expression of human breast cancer tissues showed that these proteins were present both in the cytoplasm and the nuclei. Moreover, some IGFBP-4 or IGFBP-5-positive cells were noted in the stroma of normal breast and carcinoma tissues, and the IGFBP-4 or IGFBP-5-positive cells in the stroma were considered lymphocytes or macrophages. Further studies are needed to clarify the function of IGFBP-4 and IGFBP-5 in the cytoplasm and the nuclei of cancer cells and also of stromal cells in order to understand the role of IGFBP-4 and IGFBP-5 in breast cancer.
The present study demonstrated that IGFBP-4 mRNA expression was an independent prognostic factor in breast cancer, and that patients with ER-positive breast cancer whose tumor expressed higher levels of IGFBP-4 mRNA and lower levels of IGFBP-5 mRNA had a better prognosis that those without such findings.
| Conflict of interest statement |
|---|
|
|
|---|
None declared.
| Acknowledgments |
|---|
The authors thank Mrs Mariko Nishio for her excellent technical support. This work was supported in part by Grants-in-Aid for Scientific Research from the Ministry of Education, Science, Sports and Culture in Japan 14370362.
| References |
|---|
|
|
|---|
1 Osborne CK, Shou J, Massarweh S, Schiff R. Crosstalk between estrogen receptor and growth factor receptor pathways as a cause for endocrine therapy resistance in breast cancer. Clin Cancer Res (2005) 11:865–70s.
2 Inoue A, Yoshida N, Omoto Y, Oguchi S, Yamori T, Kiyama R, et al. Development of cDNA microarray for expression profiling of estrogen-responsive genes. J Mol Endocrinol (2002) 29:175–92.[Abstract]
3 Sachdev D, Yee D. The IGF system and breast cancer. Endocr Relat Cancer (2001) 8:197–209.[Abstract]
4 Marshman E, Streuli CH. Insulin-like growth factors and insulin-like growth factor binding proteins in mammary gland function. Breast Cancer Res (2002) 4:231–9.[CrossRef][Web of Science][Medline]
5 Ali O, Cohen P, Lee KW. Epidemiology and biology of insulin-like growth factor binding protein-3 (IGFBP-3) as an anti-cancer molecule. Horm Metab Res (2003) 35:726–33.[CrossRef][Web of Science][Medline]
6 Perks CM, Holly JM. IGFBPs and breast cancer. Breast Dis (2003) 17:91–104.[Medline]
7 Renehan AG, Zwahlen M, Minder C, O'Dwyer ST, Shalet SM, Egger M. Insulin-like growth factor (IGF)-I, IGF binding protein-3, and cancer risk: systematic review and meta-regression analysis. Lancet (2004) 363:1346–53.[CrossRef][Web of Science][Medline]
8 Cheung PT, Smith EP, Shimasaki S, Ling N, Chernausek SD. Characterization of an insulin-like growth factor binding protein (IGFBP-4) produced by the B104 rat neuronal cell line: chemical and biological properties and differential synthesis by sublines. Endocrinology (1991) 129:1006–15.
9 Kiefer MC, Schmid C, Waldvogel M, Schlapfer I, Futo E, Masiarz FR, et al. Characterization of recombinant human insulin-like growth factor binding proteins 4, 5, and 6 produced in yeast. J Biol Chem (1992) 267:12692–9.
10 Neely EK, Rosenfeld RG. Insulin-like growth factors (IGFs) reduce IGF-binding protein-4 (IGFBP-4) concentration and stimulate IGFBP-3 independently of IGF receptors in human fibroblasts and epidermal cells. Endocrinology (1992) 130:985–93.
11 Allan GJ, Beattie J, Flint DJ. The role of IGFBP-5 in mammary gland development and involution. Domest Anim Endocrinol (2004) 27:257–66.[CrossRef][Web of Science][Medline]
12 Elston CW, Ellis IO. Pathological prognostic factors in breast cancer. I. The value of histological grade in breast cancer: experience from a large study with long-term follow-up. Histopathology (1991) 19:403–10.[Web of Science][Medline]
13 Goldhirsch A, Wood WC, Gelber RD, Coates AS, Thurlimann B, Senn HJ. Meeting highlights: updated international expert consensus on the primary therapy of early breast cancer. J Clin Oncol (2003) 21:3357–65.
14 Zhang Z, Yamashita H, Toyama T, Sugiura H, Omoto Y, Ando Y, et al. HDAC6 expression is correlated with better survival in breast cancer. Clin Cancer Res (2004) 10:6962–8.
15 Zhang Z, Yamashita H, Toyama T, Sugiura H, Ando Y, Mita K, et al. ATBF1-a messenger RNA expression is correlated with better prognosis in breast cancer. Clin Cancer Res (2005) 11:193–8.
16 Bieche I, Laurendeau I, Tozlu S, Olivi M, Vidaud D, Lidereau R, et al. Quantitation of MYC gene expression in sporadic breast tumors with a real-time reverse transcription-PCR assay. Cancer Res (1999) 59:2759–65.
17 Yamashita H, Nishio M, Toyama T, Sugiura H, Zhang Z, Kobayashi S, et al. Coexistence of HER2 over-expression and p53 protein accumulation is a strong prognostic molecular marker in breast cancer. Breast Cancer Res (2004) 6:R24–30.[CrossRef][Web of Science][Medline]
18 Allred DC, Harvey JM, Berardo M, Clark GM. Prognostic and predictive factors in breast cancer by immunohistochemical analysis. Mod Pathol (1998) 11:155–8.[Web of Science][Medline]
19 Figueroa JA, Jackson JG, McGuire WL, Krywicki RF, Yee D. Expression of insulin-like growth factor binding proteins in human breast cancer correlates with estrogen receptor status. J Cell Biochem (1993) 52:196–205.[CrossRef][Web of Science][Medline]
20 McGuire SE, Hilsenbeck SG, Figueroa JA, Jackson JG, Yee D. Detection of insulin-like growth factor binding proteins (IGFBPs) by ligand blotting in breast cancer tissues. Cancer Lett (1994) 77:25–32.[CrossRef][Web of Science][Medline]
21 Yee D, Sharma J, Hilsenbeck SG. Prognostic significance of insulin-like growth factor-binding protein expression in axillary lymph node-negative breast cancer. J Natl Cancer Inst (1994) 86:1785–9.
22 Rocha RL, Hilsenbeck SG, Jackson JG, Lee AV, Figueroa JA, Yee D. Correlation of insulin-like growth factor-binding protein-3 messenger RNA with protein expression in primary breast cancer tissues: detection of higher levels in tumors with poor prognostic features. J Natl Cancer Inst (1996) 88:601–6.
23 Rocha RL, Hilsenbeck SG, Jackson JG, VanDenBerg CL, Weng C, Lee AV, et al. Insulin-like growth factor binding protein-3 and insulin receptor substrate-1 in breast cancer: correlation with clinical parameters and disease-free survival. Clin Cancer Res (1997) 3:103–9.[Abstract]
24 Frasor J, Danes JM, Komm B, Chang KC, Lyttle CR, Katzenellenbogen BS. Profiling of estrogen up- and down-regulated gene expression in human breast cancer cells: insights into gene networks and pathways underlying estrogenic control of proliferation and cell phenotype. Endocrinology (2003) 144:4562–74.[CrossRef][Web of Science][Medline]
25 Wang DY, Fulthorpe R, Liss SN, Edwards EA. Identification of estrogen-responsive genes by complementary deoxyribonucleic acid microarray and characterization of a novel early estrogen-induced gene: EEIG1. Mol Endocrinol (2004) 18:402–11.
26 Frasor J, Stossi F, Danes JM, Komm B, Lyttle CR, Katzenellenbogen BS. Selective estrogen receptor modulators: discrimination of agonistic versus antagonistic activities by gene expression profiling in breast cancer cells. Cancer Res (2004) 64:1522–33.
27 Bray SE, Robertson K, Vendrell J, Nguyen C, Purdie CA, Thomson G, et al. Tamoxifen failure in breast cancer: use of gene expression array and immunohistochemistry tissue micro arrays to define a molecular signature of tamoxifen resistance. Breast Cancer Res Treat (2005) 94(suppl 1):5163.
28 van't Veer LJ, Dai H, van de Vijver MJ, He YD, Hart AA, Mao M, et al. Gene expression profiling predicts clinical outcome of breast cancer. Nature (2002) 415:530–6.[CrossRef][Medline]
29 Hao X, Sun B, Hu L, Lahdesmaki H, Dunmire V, Feng Y, et al. Differential gene and protein expression in primary breast malignancies and their lymph node metastases as revealed by combined cDNA microarray and tissue microarray analysis. Cancer (2004) 100:1110–22.[CrossRef][Web of Science][Medline]
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
I. P. Uray, Q. Shen, H.-S. Seo, H. Kim, W. W. Lamph, R. P. Bissonnette, and P. H. Brown Rexinoid-induced Expression of IGFBP-6 Requires RAR{beta}-dependent Permissive Cooperation of Retinoid Receptors and AP-1 J. Biol. Chem., January 2, 2009; 284(1): 345 - 353. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



